Aspergillus fructus — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records1

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Aspergillus fructus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈34 Mbp

01Narrative

Aspergillus fructus is a species of fungus in the genus Aspergillus. It is from the Versicolores section. The species was first described in 2012.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus fructus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKJ775481.1 ↗514 bpSouth Africa

ACGT

AAGGATCATTACTGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCTCTC …

Aspergillus fructus strain DTO:267-G6 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus fructus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 631 114 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus fructus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1