Aspergillus deflectus

Fennell & Raper · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records0

Data sources9

Biological traits0

DNA specimens3

eDNA detections76

Sources9 archives

Databases and archives Aspergillus deflectus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI76 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS15 compounds

Environmental DNA5 datasets · 2 countries76 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Aspergillus deflectus is a species of fungus in the genus Aspergillus. It produces a group of antimicrobial chemical compounds known as deflectins. Aspergillus deflectus is in rare cases pathogenic. It is from the Usti section.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition15 compounds

Compounds documented for Aspergillus deflectus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Azaphilones10

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
Aspergichromone A	present	LOTUS
Aspergichromone B	present	LOTUS
Aspergichromone C	present	LOTUS
Aspergichromone D	present	LOTUS
Aspergichromone E	present	LOTUS
Deflectin 1a	present	LOTUS
Deflectin 1b	present	LOTUS
Deflectin 2a	present	LOTUS
Deflectin 2b	present	LOTUS
Deflectin C1	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus deflectus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences8

eDNA detections76

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFJ531159.1 ↗464 bp

ACGT

CCAACCTCCCCCCCGTGAATACGTGACCCTGTTGCTTCGGCGGGGTGTCCTCCCCTTCCCGGGGGGGCCGCCGCCGGGGACCATTTAAAC …

Aspergillus deflectus strain CBS 109.55 internal transcribed spacer 1, partial sequence; 5.8 S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

09Environmental DNA76 detections

Where the DNA of Aspergillus deflectus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found76

Studies independent surveys5

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 76 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.0 °C

pH6.90 5.00–8.00

Conductivity122 µS/cm 15.0–202

Organic carbon1.14 % 0.07–5.27

Water content17.3 % 2.71–31.5

Nitrate-N12.0 mg/kg 1.00–26.0

Phosphorus64.5 mg/kg 3.00–111

Clay37.1 % 8.21–54.0

Sand31.9 % 19.4–89.7

Depth0 m 0–0.2

SoilKandosolLatLon out of rangeVertosolKurosolChromosol

30 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 14.8–20.8

Seasonal swing summer↔winter16.2 °C

Max temp (day)25.0 °C 20.7–27.6

Min temp (night)13.6 °C 10.0–14.2

Precipitation47.9 mm/mo 13.9–52.7

Air humidity55.5 % 51.1–56.4

Moisture balance-67.4 mm/mo -171–-28.9

Vapour deficit941 Pa 744–1,202

Wind speed3.20 m/s 3.00–3.30

Cloud cover22.7 % 9.80–24.8

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)