Aspergillus cremeus — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records2

Data sources7

Biological traits0

DNA specimens0

eDNA detections18

Sources7 archives

Databases and archives Aspergillus cremeus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 records

Environmental DNA6 datasets · 3 countries18 detections

DNA & barcodingNCBIsequences

01Narrative

Aspergillus cremeus is a species of fungus in the genus Aspergillus. It is from the Cremei section. The species was first described in 1965.Raper, K.B.; Fennell, D.I. 1965. The Genus Aspergillus. :1-686

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus cremeus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

eDNA detections18

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY588667.1 ↗203 bp

ACGT

TTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCCTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCT …

Aspergillus cremeus clone G-cla1-ITS2_OTU-0-070_70 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS5

fungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

09Environmental DNA18 detections

Where the DNA of Aspergillus cremeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys6

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 25.2–27.9

Seasonal swing summer↔winter1.60 °C

Max temp (day)29.2 °C 28.2–31.7

Min temp (night)24.0 °C 22.2–24.6

Precipitation327 mm/mo 62.8–347

Air humidity64.9 % 64.0–65.2

Moisture balance170 mm/mo -101–194

Vapour deficit1,225 Pa 1,130–1,365

Wind speed1.20 m/s 1.20–2.40

Cloud cover35.1 % 15.6–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.