Aspergillus conicus

Blochwitz · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records48

Data sources8

Biological traits0

DNA specimens2

eDNA detections581

Sources8 archives

Databases and archives Aspergillus conicus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI581 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF48 records

Environmental DNA7 datasets · 18 countries581 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Aspergillus conicus is a xerophilic species of fungus in the genus Aspergillus which can cause endophthalmitis in rare cases. It was first described in 1914.Dale, E. 1914. On the fungi of the soil. Part II. Fungi from chalky soil, uncultivated mountain peat, and the "black earth" of the reclaimed fenland. Annales Mycologici. 12(1):33-62 It is from the section Restricti. Aspergillus conicus has been reported as a human pathogen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus conicus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections581

Countries18

The DNA barcodea real sequence read deposited for this species

ITSOP978723.1 ↗221 bp

ACGT

TTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTCTTGTACCCTGTTGCTTCGGCGGGCCCGCCTTCATGGCCGCCGGGG …

Aspergillus conicus isolate SH1842017.08FU internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type48 records

Museum / vouchered48

Range

Area of Occupancy AOO96 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 48 records without

Open the institutions mapphysical evidence48

10Collections & institutions

Institution	Specimens
ARMS-MBONlocation not on record	6

1 institutions · 6 of 48 vouchered records shown · 42 without an institution code

09Environmental DNA581 detections

Where the DNA of Aspergillus conicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found581

Studies independent surveys7

Countries18

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 581 detections have coordinates

Open the map18 countries0

PalearcticNeotropicMarina; semi-industrial; 9.3 - Subtidal Loos…needleIndustrial port; industrial; 9.5 - Subtidal …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 7.20–16.0

Seasonal swing summer↔winter21.7 °C

Max temp (day)14.6 °C 11.6–19.1

Min temp (night)9.00 °C 2.60–11.7

Precipitation61.7 mm/mo 44.0–87.1

Air humidity60.5 % 59.3–64.6

Vapour deficit561 Pa 413–690

Cloud cover37.0 % 30.4–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 556 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)