Aspergillus cervinus

Massee · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records8

Data sources9

Biological traits0

DNA specimens9

eDNA detections143

Sources9 archives

Databases and archives Aspergillus cervinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI143 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF8 records

Environmental DNA6 datasets · 7 countries143 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Aspergillus cervinus is a species of fungus in the genus Aspergillus. It is from the Cervini section. The species was first described in 1914.Massee, G.E. 1914. Fungi exotici, XVIII. Bulletin of Miscellaneous Informations of the Royal Botanical Gardens Kew. 1914:156-159 It has been reported to produce terremutin, dihydroxy-2,5-toluquinone, xanthocillin, and sclerin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition7 compounds

Compounds documented for Aspergillus cervinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Branched fatty acids2

Benzoquinones $ Naphthoquinones1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,5R,6S)-4,5-dihydroxy-3-methyl-7-oxabicyclo[4.1.0]hept-3-en-2-one	present	LOTUS
(4S,5R)-4,5-dihydroxy-3-methoxy-5-methylcyclohex-2-en-1-one	present	LOTUS
(5R)-5-hydroxy-4-methoxy-5-[(2R)-1-methoxypropan-2-yl]furan-2-one	present	LOTUS
(5R)-5-hydroxy-4-methoxy-5-prop-1-en-2-ylfuran-2-one	present	LOTUS
2,5-Dihydroxy-3-methyl-1,4-benzoquinone	present	LOTUS
3-Methoxy-5-methyl-4-oxohexa-2,5-dienoic acid	present	LOTUS
Penicillic Acid	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus cervinus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes1

GenBank sequences10

eDNA detections143

Countries7

The DNA barcodea real sequence read deposited for this species

ITSOW847469.1 ↗313 bp

ACGT

GAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATG …

Aspergillus cervinus genomic DNA sequence contains ITS1

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

10Collections & institutions

Institution	Specimens
DPIlocation not on record	1

1 institutions · 1 of 8 vouchered records shown · 7 without an institution code

09Environmental DNA143 detections

Where the DNA of Aspergillus cervinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found143

Studies independent surveys6

Countries7

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 143 detections have coordinates

Open the map7 countries0

NeotropicAfrotropicAustralasiaIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 24.9–28.2

Seasonal swing summer↔winter1.60 °C

Max temp (day)29.1 °C 27.1–32.2

Min temp (night)23.4 °C 22.4–24.8

Precipitation177 mm/mo 76.2–373

Air humidity70.1 % 63.0–72.6

Moisture balance75.9 mm/mo -82.0–252

Vapour deficit1,047 Pa 874–1,442

Wind speed0.8 m/s 0.5–3.90

Cloud cover41.2 % 27.8–66.0

CHELSA 1981–2010, ~9 km grid, at location & month of 131 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)