Aspergillus candidus

Link · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records267

Data sources12

Biological traits0

DNA specimens20

eDNA detections225

Sources12 archives

Databases and archives Aspergillus candidus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

OBISOcean Biodiversity Information System5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI225 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS278 compounds

Occurrence & distributionGBIF · OBIS267 records

Environmental DNA4 datasets · 6 countries225 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈27 Mbp

01Narrative

Aspergillus candidus (also called A. triticus, A. albus, and A. okazakii) is a white-spored species of fungus in the genus Aspergillus. Despite its lack of pigmentation, it is closely related to the most darkly-pigmented aspergilli in the Aspergillus niger group. It is a common soil fungus worldwide and is known as a contaminant of a wide array of materials from the indoor environment to foods and products. It is an uncommon agent of onychomycosis and aspergillosis. The species epithet candidus (L.) refers to the white pigmentation of colonies of this fungus. It is from the Candidi section. The fungi in the Candidi section are known for their white spores. It has been isolated from wheat flour, djambee, and wheat grain.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition278 compounds

Compounds documented for Aspergillus candidus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

p-Terphenyls41

Gallotannins39

Flavones12

Flavonols8

Indole-Diterpenoid alkaloids (Penitrems)7

Documented compounds278 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Muurolene	present	LOTUS
(+)-Eudesma-5,7(11)-diene	present	LOTUS
(+)-Ursolic Acid	present	NPASS
(-)-beta-Phellandrene	present	LOTUS
(-)-Bicycloelemene	present	LOTUS
(10R,11R)-10-[(14R,15S,19R)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,11,17,18,19,22,23,34,35-undecahydroxy-9,13,25,32-tetraoxaheptacyclo[25.8.0.02,7.015,20.021,30.024,29.028,33]pentatriaconta-1(35),2,4,6,15,17,19,21,23,27,29,33-dodecaene-8,14,26,31-tetrone	present	NPASS
(10R,11R)-10-[(14S,15S,19R)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,11,16,17,18,21,22,33,34-undecahydroxy-9,24,31-trioxaheptacyclo[24.8.0.02,7.014,19.020,29.023,28.027,32]tetratriaconta-1(34),2,4,6,14,16,18,20,22,26,28,32-dodecaene-8,13,25,30-tetrone	present	NPASS
(10R,11R,13R,14R,15S)-3,4,5,11,14,20,21,22-octahydroxy-13-(hydroxymethyl)-9,12,16-trioxatetracyclo[16.4.0.02,7.010,15]docosa-1(22),2,4,6,18,20-hexaene-8,17-dione	present	NPASS
(1R,2S,4aS,6aR,6aS,6bS,8aS,10S,12aR,14bR)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(1R,2S,8R,10R,19R,20S,39S)-8,9,9,13,14,25,26,27,30,31,32,39-dodecahydroxy-3,18,21,36,38,40-hexaoxaoctacyclo[18.17.1.12,19.18,12.05,10.011,16.023,28.029,34]tetraconta-5,11,13,15,23,25,27,29,31,33-decaene-4,7,17,22,35-pentone	present	NPASS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus candidus has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences10

eDNA detections225

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPZ256067.1 ↗461 bpSpain · 2023

ACGT

TGAGGGTTTCTCTGAAGCCCAACCTCCCACCCGTGTATACCGTACCCTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGACCTCG …

Aspergillus candidus isolate LL39 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus candidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈27 317 772 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus candidus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness94.5% BUSCO

08Occurrence & distribution

Record type267 records

Wild obs. + sensor8

Museum / vouchered251

Cultivated / captive5

Other3

Range

Area of Occupancy AOO808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 3 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 6

9 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence251

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lincoln, US	4
Pullman, US	3
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Catholic University of Pekinglocation not on record	2
Karlsruhe, DE	2
Bronx, US	1
BDBClocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Kew, GB	1
Champaign, US	1
Musée des Confluenceslocation not on record	1
DPIlocation not on record	1
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	1
PHlocation not on record	1

14 institutions · 23 of 251 vouchered records shown · 223 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA225 detections

Where the DNA of Aspergillus candidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found225

Studies independent surveys4

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 225 detections have coordinates

Open the map6 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 9.00–26.0

pH6.80 3.30–8.90

Conductivity275 µS/cm 10.0–160,000

Organic carbon0.96 % 0.021–25.3

Water content7.87 % 0.819–34.1

Nitrate-N7.68 mg/kg 1.00–520

Phosphorus20.0 mg/kg 2.00–225

Clay15.7 % 0.91–67.0

Sand67.3 % 16.9–99.1

Depth0 m 0–0.2

SoilVertosolsVertosolKurosolTenosolCalcarosolPodosol

197 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 12.3–27.0

Seasonal swing summer↔winter10.8 °C

Max temp (day)27.1 °C 16.6–31.9

Min temp (night)15.3 °C 8.30–21.0

Precipitation38.2 mm/mo 4.80–105

Air humidity53.8 % 45.4–60.5

Moisture balance-103 mm/mo -149–7.90

Vapour deficit1,225 Pa 583–1,796

Wind speed3.40 m/s 2.40–4.40

Cloud cover25.0 % 11.8–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 210 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)