Aspergillus campestris

M.Chr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records1

Data sources9

Biological traits0

DNA specimens3

eDNA detections23

Sources9 archives

Databases and archives Aspergillus campestris's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 records

Environmental DNA5 datasets · 5 countries23 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈29 Mbp

01Narrative

Aspergillus campestris is a species of fungus in the genus Aspergillus. The species was first described in 1982.Christensen, M. 1982. The Aspergillus ochraceus group: two new species from western soils and a synoptic key. Mycologia. 74(2):210-225 It is from the Candidi section. The fungi in the Candidi section are known for their white spores. It has been shown to produce a high number of secondary metabolites. The genome of A. campestris was sequenced as a part of the Aspergillus whole-genome sequencing project - a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus.Kjaerbolling I, Vesth TC, Frisvad JC, Nybo JL, Theobald S, Kuo A, Bowyer P, Matsuda Y, Mondo S, Lyhne EK, Kogle ME, Clum A, Lipzen A, Salamov A, Ngan CY, Daum C, Chiniquy J, Barry K, LaButti K, Haridas S, Simmons BA, Magnuson JK, Mortensen UH, Larsen TO, Grigoriev IV, Baker SE, Andersen MR Linking secondary metabolites to gene clusters through genome sequencing of six diverse Aspergillus species. Proc Natl Acad Sci U S A. 2018 Jan 23;115(4):E753-E761. doi: 10.1073/pnas.1715954115. Epub 2018 Jan 9. The genome assembly size was 28.26 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Aspergillus campestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

p-Terphenyls3

Flavonols1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
3-Hydroxyterphenyllin	present	LOTUS
Candidusin C	present	LOTUS
Chlorflavonin	present	LOTUS
Terphenyllin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus campestris has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections23

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPX387213.1 ↗217 bpPoland · 2020

ACGT

TTACCGAGTGAGGGTTTCTCTGAAGCCCAACCTCCCACCCGTGTATACCGTACCCTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGG …

Aspergillus campestris clone SH1161599.08FU internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus campestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈28 643 410 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus campestris0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

09Environmental DNA23 detections

Where the DNA of Aspergillus campestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys5

Countries5

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH7.80 4.20–9.00

Conductivity94.0 µS/cm 86.0–549

Organic carbon0.86 % 0.48–5.51

Water content10.2 % 2.74–48.8

Nitrate-N2.00 mg/kg 2.00–19.0

Phosphorus27.0 mg/kg 3.00–89.0

Clay31.7 % 8.82–66.0

Sand42.7 % 0–89.2

Depth0 m 0–0.2

SoilVertosolCalcarosolTenosols

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.3 °C 10.9–25.7

Seasonal swing summer↔winter5.60 °C

Max temp (day)26.8 °C 15.2–28.0

Min temp (night)18.9 °C 7.40–25.1

Precipitation102 mm/mo 11.6–127

Air humidity62.0 % 48.3–67.2

Moisture balance6.70 mm/mo

Vapour deficit1,015 Pa 499–1,358

Wind speed2.80 m/s

Cloud cover36.9 % 12.8–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)