Aspergillus caelatus

B.W.Horn · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records8

Data sources10

Biological traits0

DNA specimens4

eDNA detections6

Sources10 archives

Databases and archives Aspergillus caelatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS13 compounds

Occurrence & distributionGBIF8 records

Environmental DNA4 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT · NCBI≈40 Mbp

01Narrative

Aspergillus caelatus is a species of fungus in the genus Aspergillus. It is from the Flavi section. The species was first described in 1997.Horn, B.W. 1997. Aspergillus caelatus, a new species in section Flavi. Mycotaxon. 61:185-192 It has been isolated from soil in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition13 compounds

Compounds documented for Aspergillus caelatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iridoids monoterpenoids6

Cinnamic acids and derivatives $ Phenylethanoids2

Pterocarpan2

Spirostane steroids1

Cinnamic acids and derivatives1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-6-[(1R,2S,3'S,4S,5'S,6S,7S,8R,9S,10R,12S,13R,16S)-3',10-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4,5-dihydroxy-2-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
6-O-Caffeoylarbutin	present	NPASS
9-methoxy-6H-[1]benzofuro[3,2-c]chromene-3,4,10-triol	present	LOTUS
9-methoxy-6H-[1]benzofuro[3,2-c]chromene-3,4,7-triol	present	LOTUS
[(2R,3S,4R,5R,6R)-2-[[(2R,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-4,5-dihydroxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
[(2R,3S,4R,5R,6R)-2-[[(2R,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxymethyl]oxan-2-yl]oxyoxan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-4,5-dihydroxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
Aucubin	present	NPASS
Catalpol	present	NPASS
Catalposide	present	NPASS
hydroquinone-O-β-D-glucopyranoside	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus caelatus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections6

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPP754385.1 ↗236 bpIndia · 2024

ACGT

AGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAG …

Aspergillus caelatus isolate 22MIM13.3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus caelatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈40 016 351 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aspergillus caelatus0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.1% BUSCO

08Occurrence & distribution

Record type8 records

Wild obs. + sensor1

Museum / vouchered7

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	1

1 institutions · 1 of 7 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Aspergillus caelatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys4

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.7–25.4

Seasonal swing summer↔winter3.40 °C

Max temp (day)27.3 °C 26.8–27.9

Min temp (night)22.6 °C 21.3–23.9

Precipitation109 mm/mo 106–113

Air humidity65.7 % 63.6–67.7

Moisture balance-30.6 mm/mo -34.7–-26.5

Vapour deficit1,093 Pa 1,049–1,138

Wind speed3.10 m/s 2.10–4.10

Cloud cover29.1 % 24.4–33.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)