Aspergillus awamori

Nakaz. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records46

Data sources13

Biological traits0

DNA specimens12

eDNA detections20

Sources13 archives

Databases and archives Aspergillus awamori's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

OBISOcean Biodiversity Information System14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS34 compounds

Occurrence & distributionGBIF · OBIS46 records

Environmental DNA2 datasets · 1 countries20 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceGoaT · NCBI≈39 Mbp

01Narrative

Aspergillus awamori is a species of aspergillus that is used to make awamori and shōchū. It can produce citric acid and convert starch to sugar. Aspergillus awamori is often confused with Aspergillus niger as they have very similar morphologies and growth rates at different temperatures, and produce several common.黒麹菌の学名が Aspergillus luchuensis になりました Osamu Yamada In 1901, Tamaki Inui, lecturer at University of Tokyo succeeded in the first isolating and culturing.＜８＞黒麹菌の役割　発酵中の雑菌繁殖防ぐ Okinawa times In 1910, Genichiro Kawachi succeeded for the first time in cultivating var. kawachi, a variety of subtaxa of A. awamori. This improved the efficiency of shōchū production.初代河内源一郎（1883～1948） Kawauchi-kin honpo

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition34 compounds

Compounds documented for Aspergillus awamori across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ergostane steroids9

Colensane and Clerodane diterpenoids5

Cholestane steroids $ Ergostane steroids3

Wax monoesters2

Atisane diterpenoids $ Kaurane and Phyllocladane diterpenoids1

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3R,5R,7S,10R,11R,14R,15R,18S)-15-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-7-hydroxy-10,14-dimethyl-4,19-dioxahexacyclo[9.8.0.01,18.03,5.05,10.014,18]nonadecan-2-one	present	LOTUS
(1R,4S,9S,10R,13S,14S)-14-hydroxy-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-6-one	present	NPASS
(22E)-5alpha-Ergosta-7,22-diene-3beta,5,6alpha-triol 6-palmitate	present	LOTUS
(4aS,7R,8S,8aR)-4,7,8-trimethyl-8-[2-(5-oxo-2H-furan-3-yl)ethyl]-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid	present	NPASS
(4aS,7R,8S,8aR)-8-[2-(furan-3-yl)ethyl]-4,7,8-trimethyl-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid	present	NPASS
(4aS,7R,8S,8aR)-8-[2-[(2R)-2-hydroxy-5-oxo-2H-furan-3-yl]ethyl]-4,7,8-trimethyl-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid	present	NPASS
(4aS,7R,8S,8aR)-8-[2-[(2S)-2-hydroxy-5-oxo-2H-furan-4-yl]ethyl]-4,7,8-trimethyl-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid	present	NPASS
(4E,6E,8E,10E,12E)-7-methyl-13-phenyltrideca-4,6,8,10,12-pentaen-3-one	present	LOTUS
1,4-Dihydro-4-oxo-6-(phenylmethyl)-3-pyridinecarboxamide	present	NPASS
22E, 24R-ergosta-7,22-diene-3beta,5alpha-diol-6beta-inoleate	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus awamori has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes2

GenBank sequences10

eDNA detections20

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMH856951.1 ↗532 bp

ACGT

TCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGC …

Aspergillus awamori strain CBS 117.52 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus awamori carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈38 597 812 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus awamori0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness99.1% BUSCO

08Occurrence & distribution

Record type46 records

Wild obs. + sensor1

Museum / vouchered44

Other1

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 44 records without

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	1

1 institutions · 1 of 44 vouchered records shown · 29 without an institution code

09Environmental DNA20 detections

Where the DNA of Aspergillus awamori was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter15.0 °C

Max temp (day)13.4 °C

Min temp (night)6.70 °C

Precipitation73.8 mm/mo

Air humidity63.8 %

Moisture balance-1.10 mm/mo

Vapour deficit487 Pa

Wind speed5.10 m/s

Cloud cover44.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)