Aspergillus avenaceus

G.Sm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records242

Data sources10

Biological traits0

DNA specimens8

eDNA detections244

Sources10 archives

Databases and archives Aspergillus avenaceus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI244 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS1 compounds

Occurrence & distributionGBIF242 records

Environmental DNA4 datasets · 2 countries244 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈34 Mbp

01Narrative

Aspergillus avenaceus is a species of fungus in the genus Aspergillus. It is from the Flavi section. The species was first described in 1943.Smith, G. 1943. Two new species of Aspergillus. Transactions of the British Mycological Society. 26(1-2):24-27 A. avenaceus has been isolated in the UK from a Pisum sativum seed, and in the United States. It has been reported to produce avenaciolide and aspirochlorine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Aspergillus avenaceus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Indolizidine alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Erythraline		present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus avenaceus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences8

eDNA detections244

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH856137.1 ↗426 bpUnited Kingdom

ACGT

CCCGAACCTCTCACCCGTGTTTACGTGACCGTGTTGCTTCGGCGGGCCGCCCTTTCGGGGCGCCCCGGGGGCGTCTGCCCCTGGAACGTG …

Aspergillus avenaceus strain CBS 109.46 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS8★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus avenaceus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 765 472 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus avenaceus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.2% BUSCO

08Occurrence & distribution

Record type242 records

Wild obs. + sensor1

Museum / vouchered241

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence241

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Scientific Institute of Public Health, Brusselslocation not on record	1
UAclocation not on record	1

2 institutions · 2 of 241 vouchered records shown · 239 without an institution code

09Environmental DNA244 detections

Where the DNA of Aspergillus avenaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found244

Studies independent surveys4

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 244 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.0 °C 18.0–21.0

pH6.73 4.05–8.90

Conductivity12,840 µS/cm 10.0–160,000

Organic carbon1.28 % 0.2–13.5

Water content3.38 % 0.93–50.8

Nitrate-N8.00 mg/kg 1.00–284

Phosphorus30.0 mg/kg 2.00–115

Clay17.1 % 0.93–69.0

Sand56.5 % 0–96.2

Depth0 m 0–0.2

SoilKandosolRudosolChromosolsTenosolsSodosolFerrosol

238 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 17.9–26.5

Seasonal swing summer↔winter10.9 °C

Max temp (day)28.7 °C 22.3–32.7

Min temp (night)16.7 °C 14.1–21.1

Precipitation7.40 mm/mo 4.40–59.7

Air humidity46.0 % 44.8–58.5

Moisture balance-113 mm/mo -142–-72.5

Vapour deficit1,460 Pa 858–1,697

Wind speed3.50 m/s 2.60–4.60

Cloud cover24.4 % 20.3–31.3

CHELSA 1981–2010, ~9 km grid, at location & month of 240 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)