Aspergillus austroafricanus

Jurjević, S.W.Peterson & B.W.Horn · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records21

Data sources9

Biological traits0

DNA specimens1

eDNA detections21

Sources9 archives

Databases and archives Aspergillus austroafricanus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS20 compounds

Occurrence & distributionGBIF21 records

Environmental DNA3 datasets · 16 countries21 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aspergillus austroafricanus is a species of fungus in the genus Aspergillus. It is from the Versicolores section. The species was first described in 2012. It has been isolated in South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition20 compounds

Compounds documented for Aspergillus austroafricanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Methyl xanthones4

Imidazole alkaloids4

Bisabolane sesquiterpenoids4

Fungal DPEs4

Quinolizidine alkaloids2

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Austrosene	present	LOTUS
(1S,9R,14E)-14-(1H-imidazol-5-ylmethylidene)-2,11-dimethoxy-9-(2-methylbut-3-en-2-yl)-2,13,16-triazatetracyclo[7.7.0.01,13.03,8]hexadeca-3,5,7,10-tetraene-12,15-dione	present	LOTUS
(3E,7aS)-3-[(1H-Imidazol-5-yl)methylidene]-6,12-dimethoxy-7a-(2-methylbut-3-en-2-yl)-7a,12-dihydro-1H,5H-imidazo[1',2':1,2]pyrido[2,3-b]indole-2,5(3H)-dione	present	LOTUS
2-Hydroxy-4-(3-hydroxy-5-methylphenoxy)-6-methylbenzamide	present	LOTUS
2-Hydroxy-4-(4-hydroxy-3-methylphenoxy)-6-methylbenzamide	present	LOTUS
4-(Hydroxymethyl)-5-hydroxy-2h-pyran-2-one	present	LOTUS
Asperpteridinate A	present	LOTUS
Austradixanthone	present	LOTUS
Ciprofloxacin	present	LOTUS
Di-6-hydroxydeoxybrevianamide E	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus austroafricanus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections21

Countries16

The DNA barcodea real sequence read deposited for this species

ITSOP303302.1 ↗487 bp

ACGT

CCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCTCTCGGGGGCGCGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATG …

Aspergillus austroafricanus isolate GXIMD01041 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type21 records

Museum / vouchered21

Range

Area of Occupancy AOO72 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

09Environmental DNA21 detections

Where the DNA of Aspergillus austroafricanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys3

Countries16

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map16 countries0

NeotropicAfrotropicPalearcticAustralasia

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 12.2–25.2

Seasonal swing summer↔winter4.70 °C

Max temp (day)24.9 °C 17.1–26.9

Min temp (night)18.9 °C 5.90–23.4

Precipitation114 mm/mo 67.1–259

Air humidity62.3 % 57.4–71.2

Moisture balance3.90 mm/mo -69.0–151

Vapour deficit911 Pa 634–1,202

Wind speed1.90 m/s 1.00–6.00

Cloud cover34.9 % 24.3–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)