Aspergillus aculeatinus

Noonim, Frisvad, Varga & Samson · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records13

Data sources10

Biological traits0

DNA specimens12

eDNA detections13

Sources10 archives

Databases and archives Aspergillus aculeatinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility12 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS13 records

Environmental DNA2 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceGoaT · NCBI≈36 Mbp

01Narrative

Aspergillus aculeatinus is a species of fungus in the genus Aspergillus. It belongs to the group of black Aspergilli which are important industrial workhorses. A. aculeatinus belongs to the Nigri section. The species was first described in 2008. A. aculeatinus has been isolated from Thai coffee beans. It has been shown to produce neoxaline, secalonic acid D and F, and aculeacins. The genome of A. aculeatinus was sequenced and published in 2014 as part of the Aspergillus whole-genome sequencing project – a project dedicated to performing whole-genome sequencing of all members of the genus Aspergillus. The genome assembly size was 36.47 Mbp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus aculeatinus has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes1

GenBank sequences10

eDNA detections13

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX102360.1 ↗291 bpIndia · 2025

ACGT

CCTGTTGCTTCGGCGGCCCGCCTTCGGGCGGCCCGGCCCTGCCCCGGACCGCGCCCGCGGAGACCCCAATGGAACACTGTCTGAAAAGCG …

Aspergillus aculeatinus isolate TM2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus aculeatinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈36 473 088 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus aculeatinus0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type13 records

Museum / vouchered11

Cultivated / captive2

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Aspergillus aculeatinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)