Aspasia lunata

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Aspasia

At a glance

Occurrence records37

Data sources7

Biological traits12

DNA specimens5

eDNA detections4

Sources7 archives

Databases and archives Aspasia lunata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Aspasia lunata is a species of orchid, native to tropical South America, in the Brazilian southeast and south and reaching Bolivia and Paraguay, from 200 - in elevation. Aspasia lunata - flower Aspasia lunata - flower and foliage

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista, Restinga

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspasia lunata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF079406.1 ↗735 bp

ACGT

AGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAAAATATATATCGAGCGATTCGAAC …

Aspasia lunata 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor2

Museum / vouchered35

Origin

Native12

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	10
Blumenau, BR	4
INMAlocation not on record	4
Bronx, US	3
Chicago, US	2
UNESClocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
UFPRlocation not on record	2
Criciúma, BR	2
UFABClocation not on record	1
Fort Worth, US	1
Saint Louis, US	1
UNESP-RClocation not on record	1

13 institutions · 35 of 35 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aspasia lunata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)