Asparagus scandens

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Asparagus

At a glance

Occurrence records6 638

Data sources9

Biological traits41

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Asparagus scandens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF6 638 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Asparagus scandens — вид рослин із родини холодкових (Asparagaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology16

Fruit length6 mm

⚠ sources differ — AusTraits: 6 mm · GIFT: 8 mm

Fruit width6 mm

⚠ sources differ — AusTraits: 6 mm · GIFT: 7 mm

Leaf length10 mm

Leaf length max15 mm

Leaf length min5 mm

Leaf width1 mm

Leaf width max1.5 mm

Leaf width min0.5 mm

Plant height2 m

Plant height max2 m

Seed length3 mm

⚠ sources differ — AusTraits: 3 mm · GIFT: 4 mm

Seed length max4 mm

Seed length min4 mm

Seed width3 mm

Seed width max3 mm

Seed width min3 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennnnnyyyyyyy

Life formclimbing perennial

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Climber

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapefalcate lanceolate linear

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus scandens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB245518.1 ↗251 bp

ACGT

CACGCCCGGGAGAGCTGAGGTAGGGCGACATCTGCCGCTTTGCCCCAGCCTCCTTGGGCACCTATTGCCGCCCCCGTCTTGCCTCGTTGC …

Asparagus scandens gene for ITS1

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asparagus scandens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Garde, MalhairosGarde 1953

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — Garde & G. 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 638 records

Wild obs. + sensor6 230

Museum / vouchered295

Cultivated / captive67

Other46

Origin

Native1

Introduced519

Range

Area of Occupancy AOO5 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 4 709≤1 km 480≤10 km 106>10 km 53

5 348 georeferenced · 882 without coordinates

Open the mapobservation + sensor6 230

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 35≤1 km 47≤10 km 35>10 km 2

119 georeferenced · 176 without coordinates

Open the institutions mapphysical evidence295

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 67 records without

Open the mapnot free-living67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	57
Auckland, NZ	51
Pretoria, ZA	34
Museo Entomologico de Leonlocation not on record	28
Adelaide, AU	24
Mount Annan, AU	16
Hobart, AU	16
Canberra, AU	12
Wellington, NZ	9
Rotorua, NZ	8
Kensington, AU	7
GHPG$location not on record	4
Cape Town, ZA	4
Palmerston North, NZ	4
Salvador, BR	2
Saint Louis, US	2
Santa Barbara, US	2
Batemans Bay, AU	2
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
Wollongong, AU	1
Moscow State Universitylocation not on record	1
Riverside, US	1
MSB-3054location not on record	1
Universidad de Caldas (UCaldas)location not on record	1
Zürich, CH	1
LNBG$location not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1
Armidale, AU	1
UFBAlocation not on record	1
CICYTEXlocation not on record	1
University of Johannesburglocation not on record	1

31 institutions · 295 of 295 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Asparagus scandens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 14.4–14.4

Seasonal swing summer↔winter8.30 °C

Max temp (day)18.4 °C

Min temp (night)10.2 °C

Precipitation95.1 mm/mo

Air humidity61.1 %

Moisture balance-33.9 mm/mo

Vapour deficit636 Pa

Wind speed3.50 m/s

Cloud cover18.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asparagus scandens

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction12

Diet & foraging1

Habitat & environment11

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 638 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 638 records