Asparagus rubicundus

P.J.Bergius · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Asparagus

At a glance

Occurrence records2 270

Data sources11

Biological traits18

DNA specimens2

eDNA detections1

Sources11 archives

Databases and archives Asparagus rubicundus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionNPASS29 compounds

Occurrence & distributionGBIF2 270 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Asparagus rubicundus ("red-stemmed asparagus") is a fluffy, thorny shrub of the Asparagus genus, that is indigenous to South Africa and southern Namibia.Asparagus rubicundus distribution - Redlist

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1.79 m

Plant height min0.4 m

Seed mass33.6 mg

⚠ sources differ — TRY: 33.6 mg · GIFT: 40.8 mg

Seed mass max52.14 mg

Seed mass min33.6 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max680 m

Elevation min10 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Herb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition29 compounds

Compounds documented for Asparagus rubicundus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids10

Ursane and Taraxastane triterpenoids5

Bauerane triterpenoids3

Cycloartane triterpenoids3

Lupane triterpenoids2

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,6S,8S,11R,12R,15R,16R)-7,7,12,16-tetramethyl-15-[(2S)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
2-[(1S,2S,4aR,4bR,6aR,10S,10aR,10bR,12aR)-1,4a,4b,6a,10-pentamethyl-9-methylidene-2-propan-2-yl-3,4,5,6,7,8,10,10a,10b,11,12,12a-dodecahydro-2H-chrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bR,6aR,10S,10aR,10bR,12aR)-1,4a,4b,6a,10-pentamethyl-9-methylidene-2-propan-2-yl-3,4,5,6,7,8,10,10a,10b,11,12,12a-dodecahydro-2H-chrysen-1-yl]ethanol	present	NPASS
2-[(1S,2S,4aR,4bR,6aS,10S,10aR,10bR,12aR)-1,4a,4b,6a,9,10-hexamethyl-2-propan-2-yl-2,3,4,5,6,7,10,10a,10b,11,12,12a-dodecahydrochrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bR,6aS,10S,10aR,10bR,12aR)-1,4a,4b,6a,9,10-hexamethyl-2-propan-2-yl-2,3,4,5,6,7,10,10a,10b,11,12,12a-dodecahydrochrysen-1-yl]ethanol	present	NPASS
2-[(1S,2S,4aR,4bS,6aR,10aS,12aR)-1,4a,4b,6a,9,9-hexamethyl-2-propan-2-yl-3,4,5,6,7,8,10,10a,12,12a-decahydro-2H-chrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bS,6aR,10aS,12aR)-1,4a,4b,6a,9,9-hexamethyl-2-propan-2-yl-3,4,5,6,7,8,10,10a,12,12a-decahydro-2H-chrysen-1-yl]ethanol	present	NPASS
2-[(1S,2S,4aR,4bS,6aR,12aR)-1,4a,4b,6a,9,9-hexamethyl-2-propan-2-yl-3,4,5,6,7,8,10,11,12,12a-decahydro-2H-chrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bS,6aR,12aR)-1,4a,4b,6a,9,9-hexamethyl-2-propan-2-yl-3,4,5,6,7,8,10,11,12,12a-decahydro-2H-chrysen-1-yl]ethanol	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus rubicundus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP110203.1 ↗552 bpSouth Africa · 2012

ACGT

AGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTGGCAGCA …

Asparagus rubicundus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Asparagus rubicundus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-ipcn66

CCDB · book-ipcn66 — Jessop 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 270 records

Wild obs. + sensor2 144

Museum / vouchered122

Other4

Range

Area of Occupancy AOO2 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 736≤1 km 130≤10 km 26>10 km 14

1 906 georeferenced · 238 without coordinates

Open the mapobservation + sensor2 144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	94
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	7
Cape Town, ZA	4
MSB-3054location not on record	3
GHPG$location not on record	3
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	3
Durban, ZA	2
South African National Biodiversity Institutelocation not on record	1
South African Environmental Observations Networklocation not on record	1

9 institutions · 118 of 122 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Asparagus rubicundus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter7.20 °C

Max temp (day)14.2 °C

Min temp (night)10.6 °C

Precipitation236 mm/mo

Air humidity59.8 %

Moisture balance155 mm/mo

Vapour deficit580 Pa

Wind speed5.70 m/s

Cloud cover10.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asparagus rubicundus

At a glance

Sources11 archives

Size & morphology5

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Compound class profile5 classes

Documented compounds29 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 270 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 270 records