Asparagus retrofractus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Asparagus

At a glance

Occurrence records565

Data sources11

Biological traits25

DNA specimens4

eDNA detections3

Sources11 archives

Databases and archives Asparagus retrofractus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility565 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF565 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT699 Mbp

01Narrative

Asparagus retrofractus — вид рослин із родини холодкових (Asparagaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology10

Leaf length16.5 mm

Leaf length max25 mm

Leaf length min8 mm

Leaf width1 mm

Leaf width max1 mm

Plant height max3 m

Plant height min0.3 m

Seed mass95.24 mg

Seed mass max95.24 mg

Seed mass min95.24 mg

Life cycle & reproduction5

Dehiscenceindehiscent

Life formscrambling perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Herb

Leaf shapefiliform

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus retrofractus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ868766.1 ↗624 bp

ACGT

CCCGCCCGGGAGAGCTGAGGGAGGGCGACATCCGCCGCTTGCCCTAGCCTCCTTGGGCACCTATGGCCGCCCCCGTCCTGCCTCGTTGCA …

Asparagus retrofractus voucher CU/BSU/PSSO7 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★trnL★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Asparagus retrofractus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size699 270 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Asparagus retrofractus0.70 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn66 · CCDB · book-fedorov +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn66 — Jessop 1966

CCDB · book-fedorov — Bozzini 1959

CCDB · kew — Stajner N, Bohanec B & Javomik B. (2002) Genetic variability of economically important Asparagus species as revealed by genome size analysis and rDNA ITS polymorphisms. Plant Science 162: 931-937

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type565 records

Wild obs. + sensor435

Museum / vouchered123

Other7

Origin

Introduced1

Range

Area of Occupancy AOO1 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 270≤1 km 22≤10 km 6>10 km 3

301 georeferenced · 134 without coordinates

Open the mapobservation + sensor435

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤1 km 11≤10 km 2

13 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	75
Cape Town, ZA	9
Saint Louis, US	4
Christchurch, NZ	4
MSB-3054location not on record	1
Wuzhou, CN	1
South African Environmental Observations Networklocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Riverside, US	1
Museo Entomologico de Leonlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Rotorua, NZ	1
Antiguo Cuscatlán, SV	1
PRClocation not on record	1
Santa Barbara, US	1

15 institutions · 103 of 123 vouchered records shown · 20 without an institution code

09Environmental DNA3 detections

Where the DNA of Asparagus retrofractus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 12.1–12.1

Seasonal swing summer↔winter13.0 °C

Max temp (day)18.2 °C

Min temp (night)6.80 °C

Precipitation38.2 mm/mo

Air humidity55.6 %

Moisture balance-44.3 mm/mo

Vapour deficit626 Pa

Wind speed3.20 m/s

Cloud cover6.50 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)