Asparagus prostratus

Dumort. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Asparagus

At a glance

Occurrence records2 453

Data sources8

Biological traits19

DNA specimens14

eDNA detections7

Sources8 archives

Databases and archives Asparagus prostratus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF2 453 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Asparagus prostratus, also known as wild asparagus, is a species of flowering plant from the genus Asparagus and family Asparagaceae. It has been placed onto the UK Biodiversity Action Plan list of priority species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology5

Plant height max1.5 m

Plant height min0.6 m

Seed mass21.49 mg

Seed mass max23.54 mg

Seed mass min19.54 mg

Life cycle & reproduction6

Dehiscenceindehiscent

Flowering endJul

Flowering startMay

Life formperennial

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formherb

Woodinessnon-woody

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus prostratus has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences4

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKX166385.1 ↗472 bpUnited Kingdom · 1999

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTACTTGGCCGAGGGCACGCCTGCCTGGGCGTCATGCCTC …

Asparagus officinalis subsp. prostratus voucher NMW068 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 453 records

Wild obs. + sensor2 116

Museum / vouchered333

Other4

Origin

Native285

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 184≤1 km 899≤10 km 988>10 km 3

2 074 georeferenced · 42 without coordinates

Open the mapobservation + sensor2 116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 3≤1 km 22≤10 km 152

177 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence333

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BMlocation not on record	32
MAlocation not on record	18
Brussel, BE	17
South Kensington, GB	14
NMWlocation not on record	13
Cambridge University Herbariumlocation not on record	11
Elocation not on record	10
Kew, GB	9
BRISTMlocation not on record	9
University of Readinglocation not on record	7
LIVlocation not on record	6
National Botanic Gardens of Irelandlocation not on record	6
University of Birminghamlocation not on record	5
University of Hulllocation not on record	5
University of Leicesterlocation not on record	4
Naturalis Biodiversity Centerlocation not on record	4
Dorset County Museumlocation not on record	3
València, ES	3
SNSNMClocation not on record	2
BM\|Klocation not on record	2
Royal Albert Memorial Museum & Art Gallerylocation not on record	2
Llocation not on record	2
BM\|DBNlocation not on record	2
National Museums Northern Ireland (Ulster Museum)location not on record	2
National Museum Waleslocation not on record	2
Dublin, IE	1
BM\|BRISTMlocation not on record	1
DBN\|NMWlocation not on record	1
Tilburg, NL	1
BM\|Elocation not on record	1
BEL\|BM\|CGE\|LTRlocation not on record	1
University of Oxfordlocation not on record	1
BMHlocation not on record	1
BM\|BTN\|Klocation not on record	1
BRISTM\|CGElocation not on record	1
BMH\|BRISTM\|LIVlocation not on record	1
BIRM\|BMlocation not on record	1
NMW\|RNGlocation not on record	1
BM\|CGE\|HLU\|NMWlocation not on record	1
PVTlocation not on record	1
Entomological Society of Latvialocation not on record	1
BM\|CGE\|NMWlocation not on record	1
Übersee-Museum Bremenlocation not on record	1
Tolson Memorial Museumlocation not on record	1

44 institutions · 209 of 333 vouchered records shown · 124 without an institution code

09Environmental DNA7 detections

Where the DNA of Asparagus prostratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

sea cliff

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 10.9–16.7

Seasonal swing summer↔winter13.6 °C

Max temp (day)17.2 °C 12.3–18.4

Min temp (night)13.0 °C 8.70–14.9

Precipitation80.2 mm/mo 62.4–117

Air humidity63.4 % 62.7–65.5

Moisture balance17.5 mm/mo

Vapour deficit637 Pa 469–696

Wind speed4.70 m/s

Cloud cover43.5 % 37.8–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asparagus prostratus

At a glance

Sources8 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging2

Habitat & environment6

At a glance

Record type2 453 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 453 records