Asparagus officinalis
speciesAt a glance
Occurrence records83 813
Data sources18
Biological traits66
DNA specimens77
eDNA detections53
Sources18 archives
Databases and archives Asparagus officinalis's data was compiled from.
WikipediaWikimedia Foundation18 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility83 813 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics77 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Chemical compositionFooDB · LOTUS · NPASS5 892 compounds
Occurrence & distributionGBIF83 813 records
Environmental DNA2 datasets · 11 countries53 detections
DNA & barcodingBOLD · NCBI77 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.9 Gbp
01Narrative
Asparagus litoralis, common name coastal asparagus, is an evergreen perennial plant species belonging to the genus Asparagus in the monocot family Asparagaceae, according to some sources, including the Black Sea Red Data Book. Other sources do not recognize this species, placing the four synonyms recognized by the Black Sea Red Data Book into two different species: Asparagus ferganensis Vved, synonym Asparagus monoclados Vved. Asparagus neglectus Kar et Kir, synonym Asparagus misczenkoi Iljin
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length7.5 mm
Fruit length max8 mm
Fruit length min7 mm
Fruit width7.5 mm
Fruit width max8 mm
Fruit width min7 mm
Leaf length17.5 mm
Leaf length max1 mm
Leaf length min0.5 mm
Leaf mass3.52 mg
Leaf size27.34 mm²
Leaf width0.75 mm
Leaf width max1 mm
Leaf width min0.5 mm
Plant height0.933 m
⚠ sources differ — GIFT: 0.933 m · AusTraits: 1.5 m · LEDA: 0.9 m · TRY: 0.931 m
Plant height generative0.9 m
Plant height max1.5 m
Plant height min0.3 m
Seed length4 mm
⚠ sources differ — TRY: 4 mm · AusTraits: 3.5 mm
Seed mass22.48 mg
⚠ sources differ — TRY: 22.48 mg · LEDA: 18.25 mg · GIFT: 33.67 mg
Seed mass max40 mg
Seed mass min19.85 mg
Seed volume24 mm³
Seed volume max24 mm³
Seed volume min24 mm³
Seed width3 mm
Seed width max3 mm
Seed width min3 mm
Life cycle & reproduction16
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJul
Flowering startMay
Flowering timeyynnnnnnyyyy
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Resprouting capacityresprouts
Seed number5
Self fertilizationabsent
Sex typedioecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
Habitat GIFTforest
Leaf compoundnesssimple
Leaf shapeacicular filiform linear subulate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)284 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)13.41 mm²/mg
⚠ sources differ — TRY: 13.41 mm²/mg · LEDA: 10.96 mm²/mg · GIFT: 10.96 mm²/mg
Other traits2
Diaspore typegerminule
Seeds per fruit11-100
03Chemical composition5 892 compounds
Compounds documented for Asparagus officinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids282
Pyridine alkaloids64
Glycerophospholipids57
Cinnamic acids and derivatives49
Unsaturated fatty acids46
Documented compounds5 892 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| D-Fructose | 12,930 mg/g dry weight | FooDB | |
| D-Mannose | 8,600 mg/g dry weight | FooDB | |
| L-Glutamic acid | 3,482.75 mg/100g | FooDB | |
| Potassium | 2,870.5 mg/100g | FooDB | |
| L-Aspartic acid | 2,467.75 mg/100g | FooDB | |
| Sugars | 1,880 mg/100g | FooDB |
05DNA & barcoding77 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus officinalis has left across the world's sequence archives.
At a glance
DNA specimens77
Marker genes8
GenBank sequences10
eDNA detections53
Countries11
The DNA barcodea real sequence read deposited for this species
TTGCGCCCGAGGCTATTCGGCCGAGGGCACGCCTGCCTGGGCGTCATGCCTCACATCGCTTCGTGCCCCCCGCCCCCCAACGGCCATACA …
Asparagus officinalis voucher CCRUM 3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL5★rbcLa★trnL-F★ITS4★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Asparagus officinalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 914 435 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Asparagus officinalis1.91 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× / 4× cytotypes
Chromosome records20–802n range20median20mode89records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2067×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +19
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BOZZINI A. - 1959. Revisione citosistematica del genere Asparagus L. 1:Le specie di Asparagus della flora italiana e chiavi analitiche per la loro determinazione.. Caryologia , 12(2): 199-264.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · brit-fl — Davies, E.W., Willis, A.J. Bot. Soc. Brit. Isles Proc. 3: 328 (1959)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4838
CCDB · fl-europaea — Bozzini, 1959
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · mediterranean
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Ma, X. H., R. L. Qin & W. B. Xing. 1985. Chromosome observation of twenty species of drug plants in Xingjiang. Acta Bot. Boreal.-Occid. Sin. 5: 149–154.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Minagawa, Y. 1993. Asparagus no hinsyu ni kansuru syomondai (3). Agric. & Hort. 68: 1011–1015.
CCDB · ipcn-api-dl — Zakirova, R. O. & I. I. Nafanailova. 1992. Chromosome numbers in members of some families of the Kazakhstan flora. Bot. Žhurn. (Moscow & Leningrad) 77(5): 71–72.
CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.
CCDB · ipcn-api-dl — Cheng, Y. c., B. k. Liu, Z. s. Jiang & Y. c. Duan. 1991. Observations of chromosome numbers of several medical plants. J. Hunan Agric. Coll. 11(2): 166–170.
CCDB · ipcn-api-dl — Bobrowski, V. L., M. I. Eckert, J. Viégas, E. Augustin & J. A. Peters. 1996. A technique to obtain metaphasic chromosomes in asparagus (Asparagus officinalis L.) spear cells. Revista Brasil. Genét. 19(2): 323–325.
CCDB · ipcn-api-dl — Rudall, P. J., E. M. Engleman, L. Hanson & M. W. Chase. 1998. Embryology, cytology and systematics of Hemiphylacus, Asparagus and Anemarrhena (Asparagales). Pl. Syst. Evol. 211: 181–199.
CCDB · ipcn-api-dl — Sheidai, M. & A. C. Inamdar. 1997. Cytomorphology of Asparagus taxa using multivariate statistical analysis. Nucleus (Calcutta) 40(1,2): 7–12.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Tamanian, K. G. & A. I. Pogosian. 1979. Cytotaxonomical studies of Caucasian species of the genus Asparagus L. (Liliaceae). Bot. Zhurn. 64 (3): 398–403.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-northern-plants — Nagao 1938.
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-indian_vol2 — Shoji, T. & Nakamura, T. 1928 ; Tischler, G. 1934 ; Osaka, S. ~938 ; Tarnavschi, I.T. 1948 ; Ishii, K. 1955, 1956 ; Braak, J.P. & Zeilinga, A.B. 1957 ; Janaki Ammal, E.K. & Kaul, B.L. 1967; Delay, J. 1968b ; Gadella, T.W.J. & Kliphuis, E. 1970a Majovsky, J. et al. 1970b
CCDB · book-fedorov — Shoji, Nakamura 1928
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Osaka 1938
CCDB · book-fedorov — Tarnavschi
CCDB · book-fedorov — Ishii K. 1955,. 1956
CCDB · book-fedorov — Braak, Zeilinga 1957
CCDB · book-fedorov — Janaki Ammal, Kaul 1967
CCDB · book-atlas-flowering-plants
CCDB · kew — Arumuganathan K, Earle ED. 1991. Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter 9: 208-218.
+24 more references
2n 4021×GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl · CCDB · fl-europaea +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Davies, E.W., Willis, A.J. Bot. Soc. Brit. Isles Proc. 3: 328 (1959)
CCDB · brit-fl — Kay, Q.O.N. (4th Aug.1994)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Kay, Q.O.N., Davies, E.W., Rich, T.C.G. Bot. J. Linn. Soc. 137: 127-137 (2001)
CCDB · fl-europaea — Davies & Willis,
CCDB · mediterranean
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · book-ipcn75-78 — Magulaev 1976
CCDB · book-indian_vol2 — Venkateswarlu, J. & R,aju, C.S.K. 1957 ;. Bozzini, A. 1959 ; Morrison, J.W. & Rajhathy, T .. 1960a ; LUve, A. & Love, D. 1964
CCDB · book-fedorov — Bozzini 1959
CCDB · book-fedorov — Morrisson J. W., J;lajhathy 1960a
CCDB · book-fedorov — Liive A., Liive D.
CCDB · book-fedorov — C. n. I. 1964)
CCDB · book-fedorov — Davies E. W., Willis 1959
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Tamanian, K. G. & A. I. Pogosian. (1979). Cytotaxonomical studies in caucasian species of the genus Asparagus L. (Liliaceae). Bot. Žurn. 64: 398-403.
CCDB · iapt — IAPT/IOPB Chromosome Data 33
2n 801×CCDB · brit-fl
CCDB · brit-fl — Davies, E.W., Willis, A.J. Bot. Soc. Brit. Isles Proc. 3: 328 (1959)
n 105×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Sheidai, M. & A. C. Inamdar. 1992. Polyploidy in the genus Asparagus L. Nucleus (Calcutta) 35(2,3): 93–97.
CCDB · book-ipcn67-71 — DELAY, J. 1968. Halophytes II. Inf. Ann. Caryosyst. et Cytogenet. 2: 17-22.
CCDB · book-ipcn67-71 — JANAKI AMMAL, E. K., F. A. Sc. & B. L. KAUL. 1967. Cytomorphological studies in autotetraploid Asparagus off icinalis L. Proc. Ind. Acad. Sci. sec. B. 65: 1-9.
CCDB · CromoCat 2015 — Delay, J. (1968b). Halophytes II. Inf. Ann. Caryosyst. et Cytogenet. 2: 17-22.
CCDB · CromoCat 2015 — Janaki Ammal, E. K., Sc, F. A. & Kaul, B. L. (1967). Cytomorphological studies in autotetraploid Asparagus officinalis L. Proc. Indiana Acad. Sci. 65: 1-9.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness83.7% BUSCO
08Occurrence & distribution
Record type83 813 records
Wild obs. + sensor76 474
Museum / vouchered6 321
Cultivated / captive158
Other860
Origin
Native243
Introduced3 102
Range
Area of Occupancy AOO151 348 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 17 637≤1 km 8 611≤10 km 35 922>10 km 1 113
63 283 georeferenced · 13 191 without coordinates
Open the mapobservation + sensor76 474
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 655≤1 km 1 024≤10 km 1 838>10 km 244
3 761 georeferenced · 2 560 without coordinates
Open the institutions mapphysical evidence6 321
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy1% within 1 km
≤1 km 1≤10 km 63>10 km 16
80 georeferenced · 78 without coordinates
Open the mapnot free-living158
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions218 of 393 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 470 |
| Uniwersytet Wrocławskilocation not on record | 382 |
| LDlocation not on record | 190 |
| Olocation not on record | 177 |
| Madison, US | 165 |
| Wuzhou, CN | 140 |
| Philadelphia, US | 136 |
| St. Paul, US | 124 |
| MeiseBGlocation not on record | 106 |
| Uppsala, SE | 96 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 90 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 90 |
| Voronezh State Universitylocation not on record | 73 |
| Adelaide, AU | 68 |
| Chongqing Museumlocation not on record | 66 |
| Oskarshamn, SE | 64 |
| Zürich, CH | 61 |
| Helsinki, FI | 57 |
| College Park, US | 51 |
| BDBClocation not on record | 51 |
| Museo Entomologico de Leonlocation not on record | 50 |
| International Salmonella Centre (W.H.O.)location not on record | 47 |
| Tartu, EE | 46 |
| SLU Artdatabankenlocation not on record | 44 |
| Bloomington, US | 44 |
| Chadron, US | 43 |
| Denver, US | 43 |
| Canberra, AU | 42 |
| Adam Mickiewicz University in Poznańlocation not on record | 41 |
| València, ES | 40 |
| Bronx, US | 40 |
| BFLlocation not on record | 38 |
| KMNlocation not on record | 36 |
| Ann Arbor, US | 36 |
| Brisbane, AU | 36 |
| CJBGlocation not on record | 34 |
| Uniwersytet Warszawskilocation not on record | 34 |
| Mount Annan, AU | 32 |
| UGentlocation not on record | 32 |
| Provincia di Livornolocation not on record | 31 |
| WTUlocation not on record | 31 |
| MAlocation not on record | 31 |
| Williamsburg, US | 31 |
| Bern, CH | 31 |
| Burlington, US | 30 |
| Barcelona, ES | 30 |
| Flagstaff, US | 29 |
| Beijing, CN | 28 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 28 |
| Görlitz, DE | 28 |
| Guangzhou, CN | 27 |
| Albuquerque, US | 26 |
| New Haven, US | 25 |
| Karlsruhe, DE | 24 |
| ASUlocation not on record | 24 |
| Saint Louis, US | 23 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 23 |
| University of New Hampshirelocation not on record | 22 |
| Zürich, CH | 21 |
| Vancouver, CA | 21 |
| University of Stellenboschlocation not on record | 21 |
| Pullman, US | 21 |
| BRNUlocation not on record | 20 |
| Nagano City, JP | 20 |
| Québec, CA | 20 |
| Green Bay, US | 20 |
| DOI/NPS, Greenbelt Parklocation not on record | 20 |
| Auckland, NZ | 19 |
| Philadelphia, US | 19 |
| Whitewater, US | 18 |
| Kensington, AU | 18 |
| Allentown, US | 18 |
| South Kensington, GB | 18 |
| BClocation not on record | 17 |
| Norfolk, US | 17 |
| Riverside, US | 17 |
| Hobart, AU | 17 |
| Berlin, DE | 16 |
| Santa Barbara, US | 16 |
| Córdoba, AR | 16 |
| Dresden, DE | 15 |
| San Diego, US | 15 |
| Christchurch, NZ | 15 |
| Claremont, US | 15 |
| Fort Worth, US | 14 |
| Durango, MX | 14 |
| BAYLUlocation not on record | 14 |
| Trondheim, NO | 14 |
| EL PASO, US | 14 |
| Caldwell, US | 14 |
| Bergen, NO | 14 |
| Wlocation not on record | 14 |
| Appalachian State Universitylocation not on record | 13 |
| Logan, US | 13 |
| Spearfish, US | 13 |
| Tacoma, US | 13 |
| Boise, US | 13 |
| Université Lavallocation not on record | 12 |
| Canadian Department of Agriculturelocation not on record | 12 |
| Moscow, US | 12 |
| Irkutsk State Universitylocation not on record | 12 |
| Corvallis, US | 11 |
| Henderson State Universitylocation not on record | 11 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 11 |
| Chapel Hill, US | 11 |
| Keene State Universitylocation not on record | 11 |
| Montréal, CA | 10 |
| Lord Fairfax Community Collegelocation not on record | 10 |
| GJOlocation not on record | 10 |
| Durango, US | 10 |
| Universidad de Caldas (UCaldas)location not on record | 10 |
| SVK001location not on record | 10 |
| Fayetteville, US | 9 |
| Tuscaloosa, US | 9 |
| Davenport, US | 9 |
| SXTCMlocation not on record | 9 |
| Bozeman, US | 9 |
| Chicago, US | 9 |
| Dekalb, US | 9 |
| Grand Junction, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Turku, FI | 9 |
| Tampa, US | 9 |
| University of Wisconsinlocation not on record | 8 |
| Zhengzhou, CN | 8 |
| Irvine, US | 8 |
| Jaén, ES | 8 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 8 |
| Odawara, JP | 8 |
| Kew, GB | 8 |
| Guasave, MX | 8 |
| Otaru, JP | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 8 |
| Bangkok, TH | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| Salamanca, ES | 7 |
| Mississippi State, US | 7 |
| HUN003location not on record | 7 |
| Staten Island, US | 7 |
| Pocatello, US | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Salzburg, AT | 7 |
| Knoxville, US | 7 |
| NMBU:MINAlocation not on record | 7 |
| Victoria, CA | 6 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 6 |
| Porrentruy, CH | 6 |
| Toronto, CA | 6 |
| Kuopio, FI | 6 |
| Hazara Universitylocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Mlocation not on record | 6 |
| TROMlocation not on record | 6 |
| Tallinn, EE | 6 |
| Hudson, US | 5 |
| US | 5 |
| Waverly, US | 5 |
| Morgantown, US | 5 |
| Austin, US | 5 |
| Jackson, US | 5 |
| Phoenix, US | 5 |
| Shinshu Universitylocation not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| WNNUlocation not on record | 5 |
| Fredericksburg, US | 5 |
| Acadia Universitylocation not on record | 5 |
| San Luis Obispo, US | 5 |
| Frauenfeld, CH | 5 |
| Little Rock, US | 5 |
| Durham, US | 5 |
| Weber State Universitylocation not on record | 5 |
| Oulu, FI | 5 |
| Columbia, US | 4 |
| Long Beach, US | 4 |
| Kochi, JP | 4 |
| UChlocation not on record | 4 |
| Provo, US | 4 |
| Clemson, US | 4 |
| Xian, CN | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Batemans Bay, AU | 4 |
| University of Winnipeglocation not on record | 4 |
| Porvoo, FI | 4 |
| Arcata, US | 4 |
| Toyama, JP | 4 |
| Washington, US | 4 |
| Tsukuba, JP | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Alicante, ES | 4 |
| Xiamen, CN | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Wellington, NZ | 4 |
| Jyväskylä, FI | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 4 |
| AUAlocation not on record | 4 |
| BSBIlocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Lincoln, US | 4 |
| US | 4 |
| Saint John, CA | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Chicago, US | 4 |
| Bourges, FR | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Western Carolina Universitylocation not on record | 3 |
| Sanda, JP | 3 |
| Gifu prefectural Museumlocation not on record | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Chiba, JP | 3 |
| Stockholm, SE | 3 |
| Angwin, US | 3 |
| Mexico City, MX | 3 |
| Rotorua, NZ | 3 |
| Missoula, US | 3 |
| Antiguo Cuscatlán, SV | 3 |
| CICYTEXlocation not on record | 3 |
| Armidale, AU | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Portland, US | 3 |
| PRClocation not on record | 3 |
| Badajoz, ES | 3 |
| Brookings, US | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Puerto Ayora, EC | 3 |
| Frankfurt am Main | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Montréal, CA | 3 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Fukushima Universitylocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Orem, US | 2 |
| Chengdu, CN | 2 |
| University of Hulllocation not on record | 2 |
| VALElocation not on record | 2 |
| Stephenville, US | 2 |
| Kunming, CN | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Kushiro City Museumlocation not on record | 2 |
| Madrid, ES | 2 |
| H-Schuhwlocation not on record | 2 |
| Fairfax, US | 2 |
| Millersville, US | 2 |
| KRUlocation not on record | 2 |
| Pittsburg, US | 2 |
| Institute of Botany, Ilia State Universitylocation not on record | 2 |
| ISAlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| DBF-NHMDlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| University of Birminghamlocation not on record | 2 |
| PrivatHerblocation not on record | 2 |
| Baroda, IN | 2 |
| The University of Arizonalocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Copenhagen, DK | 2 |
| Samara National Research Universitylocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Guangzhou, CN | 2 |
| TAIElocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Chapingo, MX | 2 |
| Córdoba, ES | 2 |
| Chicago, US | 2 |
| Davis, US | 2 |
| San Angelo, US | 2 |
| Due West, US | 2 |
| CASlocation not on record | 2 |
| Northeastern Forestry Universitylocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| New Brunswick, US | 2 |
| University of Alberta Museumslocation not on record | 2 |
| SWE054location not on record | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| Yangling, CN | 2 |
| Guatemala City, GT | 2 |
| Winterthur, CH | 2 |
| Guilin, CN | 2 |
| Conway, US | 2 |
| Lanzhou, CN | 2 |
| Nanjing, CN | 2 |
| Ypsilanti, US | 2 |
| Muzaffarabad, PK | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| SWlocation not on record | 2 |
| San Bernardino, US | 2 |
| Dover, US | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Ciudad de México, MX | 1 |
| Riobamba, EC | 1 |
| FJIDClocation not on record | 1 |
| WINlocation not on record | 1 |
| Guiyang, CN | 1 |
| South China Normal Universitylocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| MMHNSRlocation not on record | 1 |
| Richmond, US | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Firenze, IT | 1 |
| Salvador, BR | 1 |
| Shenzhen, CN | 1 |
| Peking Universitylocation not on record | 1 |
| Chengdu, CN | 1 |
| ARM059location not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Miami, US | 1 |
| Tilburg, NL | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Brussel, BE | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Bando, JP | 1 |
| Sapporo, JP | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| GAlocation not on record | 1 |
| BMHlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| US | 1 |
| Tomioka, JP | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Northridge, US | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Uberlândia, BR | 1 |
| Coimbra, PT | 1 |
| Taipei, TW | 1 |
| H-Dueringlocation not on record | 1 |
| Harrisonburg, US | 1 |
| OLAlocation not on record | 1 |
| ESP198location not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Stockholm, SE | 1 |
| Clocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Taipei, TW | 1 |
| JP | 1 |
| Urumqi, CN | 1 |
| Podgorica, ME | 1 |
| Paris, FR | 1 |
| Mohonk Preservelocation not on record | 1 |
| Lubbock, US | 1 |
| UIBlocation not on record | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| ESP106location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| TUR-Alocation not on record | 1 |
| AZE014location not on record | 1 |
| Wollongong, AU | 1 |
| Sion, CH | 1 |
| Mexico City, MX | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Henderson, US | 1 |
| Denton, US | 1 |
| Emporia, US | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Mexico City, MX | 1 |
| Edinburgh, GB | 1 |
| CONCOLlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Palmerston, AU | 1 |
| nbflocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Whitehorse, CA | 1 |
| La Trobe Universitylocation not on record | 1 |
| KR | 1 |
| Palmerston North, NZ | 1 |
| FUNEDlocation not on record | 1 |
| Philadelphia, US | 1 |
393 institutions · 5 585 of 6 321 vouchered records shown · 663 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA53 detections
Where the DNA of Asparagus officinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found53
Studies independent surveys2
Countries11
Verifiable raw sequence linked1
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 53 detections have coordinates
Open the map11 countries0
Grand CanyonGrowing on bank of Gardner River (roadside)AllotmentRiparian & Ruderal with Quercus agrifolia, S…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 12.6–21.7
Seasonal swing summer↔winter15.3 °C
Max temp (day)19.9 °C 16.9–27.8
Min temp (night)12.4 °C 6.10–18.2
Precipitation68.3 mm/mo 9.30–94.2
Air humidity58.3 % 46.7–62.9
Moisture balance-49.7 mm/mo -95.7–-8.90
Vapour deficit779 Pa 621–1,280
Wind speed3.30 m/s 2.20–4.50
Cloud cover39.4 % 25.4–50.6
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.