Asparagus lignosus

Burm.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Asparagus

At a glance

Occurrence records615

Data sources8

Biological traits13

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Asparagus lignosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility615 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF615 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Asparagus lignosus ("Katdoring") is a thorny, spindly creeper of the Asparagus genus, that is indigenous to the Western Cape Province of South Africa.Asparagus lignosus distribution - Redlist

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1 m

Plant height min0.4 m

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus lignosus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392160.1 ↗481 bp

ACGT

GCCTCCTTGGGNACCTATGGCCGCCCCCGTCCTGCCTTTCTGCCAAAACGGGTGGCGGGAACATTACCCCGGCGCAGTGTGCGCCAAGGA …

Asparagus lignosus voucher Muasya & Zhigila 7965 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type615 records

Wild obs. + sensor552

Museum / vouchered63

Range

Area of Occupancy AOO1 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 458≤1 km 35≤10 km 3>10 km 3

499 georeferenced · 53 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 63 records without

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	47
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	5
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	3
GHPG$location not on record	2
Cape Town, ZA	1
Plocation not on record	1
University of Johannesburglocation not on record	1
South African Environmental Observations Networklocation not on record	1
University of Hamburglocation not on record	1

9 institutions · 62 of 63 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Asparagus lignosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.5–12.7

Seasonal swing summer↔winter7.20 °C

Max temp (day)14.4 °C 14.2–14.5

Min temp (night)10.7 °C 10.6–10.7

Precipitation192 mm/mo 157–227

Air humidity61.3 % 60.1–62.5

Moisture balance95.2 mm/mo 47.0–143

Vapour deficit563 Pa 550–577

Wind speed5.90 m/s 5.70–6.20

Cloud cover12.2 % 11.2–13.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)