Asparagus aphyllus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Asparagus

At a glance

Occurrence records8 836

Data sources14

Biological traits21

DNA specimens1

eDNA detections0

Sources14 archives

Databases and archives Asparagus aphyllus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 836 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF8 836 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex1.2 Gbp

01Narrative

Asparagus aphyllus is a species of plants in the family Asparagaceae. They are climbing plants. Flowers are visited by the Western honey bee, Syritta pipiens, Phthiria, and Halictus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology6

Fruit length6.5 mm

Fruit width7.4 mm

Seed mass54.83 mg

⚠ sources differ — TRY: 54.83 mg · GIFT: 39 mg

Seed volume28 mm³

Seed volume max28 mm³

Seed volume min28 mm³

Life cycle & reproduction5

Dehiscenceindehiscent

Dispersal typeanimal

Life formperennial

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asparagus aphyllus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMZ867720.1 ↗443 bpTurkey

ACGT

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGAGCGGACAACTGTGAACTAATAAACCCGCCCGGGAGA …

Asparagus aphyllus small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Asparagus aphyllus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 222 500 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Asparagus aphyllus1.22 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–402n range30median20mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl +2

GoaT · Tree of Sex Database — ↗

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 528-543. Pastor Daz, J., I. Fernndez & M. J. Dez.Lagascalia15(1): 124-129(1988).

CCDB · ipcn-api-dl — Pastor, J., I. Fernández & M. Díez. 1988. Números cromosómicos para la flora Española. 528--543. Lagascalia 15: 124–129.

TreeOfSex · plant — Goldblatt1979 ↗

2n 405×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +1

CCDB · ita-fl — BOZZINI A. - 1959. Revisione citosistematica del genere Asparagus L. 1:Le specie di Asparagus della flora italiana e chiavi analitiche per la loro determinazione.. Caryologia , 12(2): 199-264.

CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).

CCDB · fl-europaea — Bozzini, 1959

CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.

n 101×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Ruiz Rejon 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 836 records

Wild obs. + sensor7 922

Museum / vouchered828

Other86

Origin

Native61

Range

Area of Occupancy AOO11 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 1 058≤1 km 272≤10 km 956>10 km 29

2 315 georeferenced · 5 607 without coordinates

Open the mapobservation + sensor7 922

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 3≤1 km 30≤10 km 9

42 georeferenced · 786 without coordinates

Open the institutions mapphysical evidence828

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sevilla, ES	537
LDlocation not on record	87
ISAlocation not on record	77
MAlocation not on record	22
CICYTEXlocation not on record	16
Badajoz, ES	13
Rishon Le Zion, IL	9
BIO-UNIPIlocation not on record	9
Paris, FR	7
Barcelona, ES	5
College of the Atlantic, Museumlocation not on record	4
Wlocation not on record	3
Kew, GB	3
Dresden, DE	3
Museo Achille Folettolocation not on record	3
Coimbra, PT	3
Sevilla, ES	3
Granada, ES	3
Entomological Society of Latvialocation not on record	3
Córdoba, ES	2
Salamanca, ES	2
Moscow State Universitylocation not on record	2
BDBClocation not on record	2
BClocation not on record	2
València, ES	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Jaén, ES	1
Berlin, DE	1
Alicante, ES	1
Santiago de Compostela, ES	1

30 institutions · 827 of 828 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asparagus aphyllus

At a glance

Sources14 archives

Size & morphology6

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type8 836 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 30 geolocated

Record type8 836 records