Aspalathus linearis

(Burm.f.) R.Dahlgren · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records359

Data sources13

Biological traits3

DNA specimens7

eDNA detections6

Sources13 archives

Databases and archives Aspalathus linearis's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility359 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS286 compounds

Occurrence & distributionGBIF359 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Flowers Plant Rooibos ( ; ; Aspalathus linearis), meaning "red bush", is a broom-like member of the plant family Fabaceae that grows in South Africa's fynbos. The leaves are used to make a herbal tea that is called by the names: rooibos (especially in Southern Africa), bush tea, red tea, or redbush tea (predominantly in Great Britain). The tea has been popular in Southern Africa for generations, and since the 2000s has gained popularity internationally. The tea has an earthy flavour, similar to yerba mate or tobacco. Rooibos was formerly classified as Psoralea but is now thought to be part of Aspalathus following Dahlgren (1980). The specific name of linearis was given by Burman (1759) for the plant's linear growing structure and needle-like leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formsubshrub or shrub

Habitat & environment2

Climatesubtropical

Growth formshrub

03Chemical composition286 compounds

Compounds documented for Aspalathus linearis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented

Compound class profile5 classes

Flavones18

Cinnamic acids and derivatives12

Flavonols11

Fatty alcohols10

Simple phenolic acids10

Documented compounds286 total

Tissue Source Quantified only

Compound	Amount	Source
GUAIACOL	240,000 ppm	DukesPhytochem
ASCORBIC-ACID	94,000 ppm	DukesPhytochem
PROTEIN	69,000 ppm	DukesPhytochem
6-METHYL-HEPTA-3,5-DIEN-2-ONE-ISOMER-A	51,800 ppm	DukesPhytochem
DAMASCENONE	50,500 ppm	DukesPhytochem
GALLIC-ACID	44,000 ppm	DukesPhytochem
TANNIN	44,000 ppm	DukesPhytochem
BETA-PHENYLETHYLALCOHOL	40,700 ppm	DukesPhytochem
6-METHYL-HEPT-5-EN-2-ONE	39,700 ppm	DukesPhytochem

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus linearis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN736479.1 ↗707 bpSouth Africa

ACGT

GCGACGTTGTGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA …

Aspalathus linearis isolate WT1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aspalathus linearis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · Oberlander2016 +1

CCDB · book-ipcn67-71 — DAHLGREN, R. 1968. Revision of the genus Aspalathus. II. The species with ericoid and pinoid leaflets. Subgenus Nortieria. With remarks on Rooibos tea cultivation. Bot. Not. 121: 165-208.

CCDB · book-ipcn73-74 — DAHLGREN, R. 1971. Chromosome numbers in the South African genus Aspalathus L. Bot. Notiser 124: 383-398.

CCDB · Oberlander2016 — Dahlgren, 1971

CCDB · Cave1963 — Dahlgren 1963

n 1341×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type359 records

Wild obs. + sensor113

Museum / vouchered245

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 97≤1 km 5>10 km 1

103 georeferenced · 10 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 243 without coordinates

Open the institutions mapphysical evidence245

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	147
Pretoria, ZA	91
Moscow State Universitylocation not on record	2
University of Cape Townlocation not on record	1
Cape Town, ZA	1
Canberra, AU	1
LDlocation not on record	1

7 institutions · 244 of 245 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Aspalathus linearis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–17.8

Seasonal swing summer↔winter12.3 °C

Max temp (day)24.4 °C

Min temp (night)11.0 °C

Precipitation24.9 mm/mo

Air humidity52.9 %

Moisture balance-116 mm/mo

Vapour deficit958 Pa

Wind speed2.60 m/s

Cloud cover12.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)