Aspalathus ciliaris

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records918

Data sources9

Biological traits4

DNA specimens9

eDNA detections5

Sources9 archives

Databases and archives Aspalathus ciliaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility918 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources4 traits

Occurrence & distributionGBIF918 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Achyronia leucophaea là một loài thực vật có hoa trong họ Đậu. Loài này được (Harv.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formshrub

Habitat & environment3

Climatesubtropical

Climberself-supporting

Growth formshrub

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus ciliaris has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences3

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU000585.1 ↗622 bp

ACGT

ATTGTCGAAGCCTCACAAACAGTGTGACCCGTGAATTTGTTTGACCACTCAGGGGTGGCCAGAGGTGTCCGGCTCCTCGGCCCCCCTCGT …

Aspalathus ciliaris voucher J. A. Hawkins 220 small subunit ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aspalathus ciliaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn73-74 — DAHLGREN, R. 1971. Chromosome numbers in the South African genus Aspalathus L. Bot. Notiser 124: 383-398.

CCDB · Oberlander2016 — Dahlgren, 1971

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type918 records

Wild obs. + sensor388

Museum / vouchered530

Range

Area of Occupancy AOO1 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 300≤1 km 31≤10 km 8>10 km 1

340 georeferenced · 48 without coordinates

Open the mapobservation + sensor388

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 527 without coordinates

Open the institutions mapphysical evidence530

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	231
Pretoria, ZA	173
LDlocation not on record	90
GHPG$location not on record	9
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
University of Cape Town, Bolus Herbariumlocation not on record	3
Bronx, US	2
Durban, ZA	2
Zürich, CH	2
South Kensington, GB	2
South African Environmental Observations Networklocation not on record	1
Tampa, US	1
Moscow State Universitylocation not on record	1
STUlocation not on record	1

14 institutions · 522 of 530 vouchered records shown · 8 without an institution code

09Environmental DNA5 detections

Where the DNA of Aspalathus ciliaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 14.0–19.6

Seasonal swing summer↔winter7.40 °C

Max temp (day)20.9 °C 16.1–22.6

Min temp (night)14.9 °C 11.8–16.5

Precipitation40.6 mm/mo 21.7–181

Air humidity59.4 % 58.9–60.4

Moisture balance-112 mm/mo -154–81.0

Vapour deficit828 Pa 654–926

Wind speed3.50 m/s 2.90–5.00

Cloud cover11.7 % 10.4–15.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)