Aspalathus cephalotes

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records104

Data sources9

Biological traits6

DNA specimens3

eDNA detections4

Sources9 archives

Databases and archives Aspalathus cephalotes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Achyronia cephalotes là một loài thực vật có hoa trong họ Đậu. Loài này được (Thunb.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass2.9 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatesubtropical

Growth formshrub

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus cephalotes has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSZ72309.1 ↗220 bp

ACGT

CATCGTTGCCCCAGTGCCCTGGCCTCGTGCTAGGCACCGAGCGGGGCGAGTGCTGGCTTCCCGTGAGCAACGCCTCACGGTTGGTTGAAA …

Aspalathus cephalotes ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aspalathus cephalotes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · Oberlander2016

CCDB · Oberlander2016 — Dahlgren, 1971

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.844 ↗

08Occurrence & distribution

Record type104 records

Wild obs. + sensor91

Museum / vouchered13

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 65≤1 km 7≤10 km 1>10 km 1

74 georeferenced · 17 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	8
Cape Town, ZA	2
University of Cape Townlocation not on record	1
Philadelphia, US	1
Saint Louis, US	1

5 institutions · 13 of 13 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aspalathus cephalotes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter10.6 °C

Max temp (day)19.7 °C

Min temp (night)10.2 °C

Precipitation195 mm/mo

Air humidity60.1 %

Moisture balance125 mm/mo

Vapour deficit658 Pa

Wind speed3.50 m/s

Cloud cover10.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)