Aspalathus capitata

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records279

Data sources7

Biological traits5

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Aspalathus capitata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility279 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF279 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Achyronia glomerata là một loài thực vật có hoa trong họ Đậu. Loài này được (Benth.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass9.23 mg

Life cycle & reproduction1

Life formshrub or tree

Habitat & environment3

Climatesubtropical

Growth formtree

Woodinesswoody

03Chemical composition4 compounds

Compounds documented for Aspalathus capitata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Quinolizidine alkaloids4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Lupanine	present	LOTUS
(1R,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1R,2R,9S,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
Sparteine	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus capitata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEF457607.1 ↗622 bp

ACGT

ATTGTCGAAGCCTCACAAACAGTGTGACCCGTGAATTTGTTTGACCACCCAGGGGTGGCTAGAGGTGTTTGGCTCCTCGGTCCCCCTCGT …

Aspalathus capitata voucher M. Crisp s.n. small subunit ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type279 records

Wild obs. + sensor244

Museum / vouchered35

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 208≤1 km 8≤10 km 4>10 km 1

221 georeferenced · 23 without coordinates

Open the mapobservation + sensor244

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 2

7 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	12
Cape Town, ZA	10
Kew, GB	5
LDlocation not on record	5
South African National Biodiversity Institutelocation not on record	1
Zürich, CH	1
Philadelphia, US	1

7 institutions · 35 of 35 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aspalathus capitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)