Aspalathus callosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records432

Data sources9

Biological traits2

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Aspalathus callosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF432 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Achyronia callosa là một loài thực vật có hoa trong họ Đậu. Loài này được (L.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formsubshrub or shrub

Habitat & environment1

Climatesubtropical

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus callosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU000582.1 ↗622 bp

ACGT

ATTGTCGAAGCCTCACAAACAGTGTGACCCGTGAATTTGTTTGACCACTCAGGGGTGGCCAGAGGTGTTCGGCTCCTCGGTCCCCCTCGT …

Aspalathus callosa voucher J. A. Hawkins 206 small subunit ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aspalathus callosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn73-74 — DAHLGREN, R. 1971. Chromosome numbers in the South African genus Aspalathus L. Bot. Notiser 124: 383-398.

CCDB · Oberlander2016 — Dahlgren, 1971

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.824 ↗

08Occurrence & distribution

Record type432 records

Wild obs. + sensor272

Museum / vouchered160

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 217≤1 km 19≤10 km 5>10 km 1

242 georeferenced · 30 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	69
Pretoria, ZA	62
LDlocation not on record	14
GHPG$location not on record	5
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
MSB-3054location not on record	2
University of Cape Townlocation not on record	1
Zürich, CH	1
Moscow State Universitylocation not on record	1
Philadelphia, US	1

10 institutions · 160 of 160 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aspalathus callosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 15.5–15.5

Seasonal swing summer↔winter4.80 °C

Max temp (day)16.2 °C

Min temp (night)14.8 °C

Precipitation37.2 mm/mo

Air humidity61.6 %

Vapour deficit673 Pa

Cloud cover14.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)