Aspalathus astroites

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records137

Data sources10

Biological traits2

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Aspalathus astroites's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Achyronia astroites là một loài thực vật có hoa trong họ Đậu. Loài này được (L.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatesubtropical

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus astroites has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU000579.1 ↗620 bp

ACGT

ATTGTCGAAGCCTCACAAACAGTGTGACCCGTGAATTTGTTTGACCACTCAGGGGTGGCCAGAGGTGTTCGGCTCCTCGGTCCCCCTCGT …

Aspalathus astroites voucher J. A. Hawkins 157 small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aspalathus astroites carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn67-71 — DAHLGREN, R. 1968. Revision of the genus Aspalathus. Opera Bot. 21: 1-309.

CCDB · book-ipcn67-71 — DAHLGREN, R. 1969. Revision of the genus Aspalathus. II. The species with ericoid and pinoid leaflets. Opera Botanica, No. 21.

CCDB · book-ipcn73-74 — DAHLGREN, R. 1971. Chromosome numbers in the South African genus Aspalathus L. Bot. Notiser 124: 383-398.

CCDB · Oberlander2016 — Dahlgren, 1971

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.844 ↗

08Occurrence & distribution

Record type137 records

Wild obs. + sensor90

Museum / vouchered47

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 75≤1 km 5≤10 km 1

81 georeferenced · 9 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	19
Cape Town, ZA	16
LDlocation not on record	8
University of Cape Townlocation not on record	2
Philadelphia, US	2

5 institutions · 47 of 47 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aspalathus astroites was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.9–16.9

Seasonal swing summer↔winter11.0 °C

Max temp (day)20.2 °C 18.4–22.0

Min temp (night)9.20 °C 7.10–11.3

Precipitation103 mm/mo 91.3–115

Air humidity56.7 % 56.0–57.3

Moisture balance-42.3 mm/mo -43.4–-41.2

Vapour deficit742 Pa 661–823

Wind speed4.50 m/s 3.60–5.50

Cloud cover13.4 % 13.0–13.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)