Aspalathus acuminata

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aspalathus

At a glance

Occurrence records125

Data sources10

Biological traits6

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Aspalathus acuminata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Achyronia acuminata là một loài thực vật có hoa trong họ Đậu. Loài này được (Lam.) Kuntze mô tả khoa học đầu tiên năm 1891.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formshrub

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Aspalathus acuminata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspalathus acuminata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF457587.1 ↗622 bp

ACGT

ATTGTCGAAGCCTCACAAACAGTGTGACCCGTGAATTTGTTTGACCACTCAGGGGTGGCCAGAGGTGTTCGGCTCCTCGGTCCCCCTCGT …

Aspalathus acuminata voucher J.A. Hawkins 189 small subunit ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aspalathus acuminata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn67-71 — DAHLGREN, R. 1968. Revision of the genus Aspalathus. Opera Bot. 21: 1-309.

CCDB · book-ipcn67-71 — DAHLGREN, R. 1969. Revision of the genus Aspalathus. II. The species with ericoid and pinoid leaflets. Opera Botanica, No. 21.

CCDB · book-ipcn73-74 — DAHLGREN, R. 1971. Chromosome numbers in the South African genus Aspalathus L. Bot. Notiser 124: 383-398.

CCDB · Oberlander2016 — Dahlgren, 1971

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.868 ↗

08Occurrence & distribution

Record type125 records

Wild obs. + sensor114

Museum / vouchered11

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 81≤1 km 7≤10 km 4>10 km 2

94 georeferenced · 20 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	4
LDlocation not on record	3
Zürich, CH	2
University of Cape Townlocation not on record	1
Cape Town, ZA	1

5 institutions · 11 of 11 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aspalathus acuminata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 12.9–12.9

Seasonal swing summer↔winter12.3 °C

Max temp (day)19.2 °C

Min temp (night)6.70 °C

Precipitation46.8 mm/mo

Air humidity56.3 %

Moisture balance-38.5 mm/mo

Vapour deficit652 Pa

Wind speed3.00 m/s

Cloud cover10.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)