Askellia elegans

(Hook.) W.A.Weber · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Askellia

At a glance

Occurrence records332

Data sources9

Biological traits8

DNA specimens7

eDNA detections3

Sources9 archives

Databases and archives Askellia elegans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility332 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF332 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Askellia elegans, the elegant hawksbeard, is a species of North American plants in the tribe Cichorieae within the family Asteraceae. It is native to central and western Canada (Yukon, Northwest Territories, British Columbia, Alberta, Saskatchewan, Manitoba, Ontario) and the northwestern United States (Alaska, Montana, Wyoming).Biota of North America Program, 2014 state-level distribution map Askellia elegans is a perennial up to 30 cm (12 inches) tall, with a deep taproot and large underground caudex. Stems are sometimes erect, but sometimes trailing along the ground. One plant can have more than 100 small flower heads, each with 6-10 yellow ray florets but no disc florets.Flora of North America Elegant hawksbeard, Crepis elegans Hooker, Fl. Bor.-Amer. 1: 297. 1833.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Askellia elegans has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG220105.1 ↗353 bpCanada · 1998

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAACCATCCGGTTGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Askellia elegans voucher CCDB-18322-C8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Askellia elegans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.

CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.

CCDB · eflora

n 71×CCDB · book-ipcn72

CCDB · book-ipcn72 — MULLIGAN, G.A., W.J. CODY, & N. GRAINGER. 1972. In IOPB chromosome reports XXXVII. Taxon 21: 495-500.

08Occurrence & distribution

Record type332 records

Wild obs. + sensor172

Museum / vouchered160

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 89≤1 km 15≤10 km 9>10 km 2

115 georeferenced · 57 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 1≤1 km 4≤10 km 31>10 km 5

41 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	60
University of Alberta Museumslocation not on record	43
Vancouver, CA	21
University of Stellenboschlocation not on record	8
Montréal, CA	7
Whitehorse, CA	5
LDlocation not on record	3
Research Collection of B. A. Bennettlocation not on record	2
Moscow State Universitylocation not on record	2
University of Lethbridgelocation not on record	2
Canadian Museum of Naturelocation not on record	1
Royal Alberta Museumlocation not on record	1
Québec, CA	1
Olocation not on record	1
Pittsburg, US	1
B.A. Bennett Herbariumlocation not on record	1

16 institutions · 159 of 160 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Askellia elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Pioneer Vegetation River TerraceGravelly soils with Minuartia dawsonensis, P…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 5.80–13.7

Seasonal swing summer↔winter32.5 °C

Max temp (day)17.8 °C 9.40–17.8

Min temp (night)7.70 °C 0.9–8.50

Precipitation93.5 mm/mo 86.9–107

Air humidity57.6 % 55.9–61.9

Moisture balance-26.0 mm/mo -28.3–-1.80

Vapour deficit636 Pa 368–694

Wind speed3.20 m/s 2.90–5.50

Cloud cover41.6 % 35.6–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)