Asimina obovata

(Willd.) Nash · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Asimina

At a glance

Occurrence records1 490

Data sources12

Biological traits7

DNA specimens3

eDNA detections10

Sources12 archives

Databases and archives Asimina obovata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 490 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF1 490 records

Environmental DNA2 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Asimina obovata, the bigflower pawpaw, is a shrub or small tree in the custard apple family. It is an endemic nativeAtlas of Florida Vascular Plants to Florida, where it is found on open sandy hammocks and in dry woods.Flora of North America Showy white flowers in late winter to early summer are followed by large green edible fruit. Its pollen is shed as permanent tetrads.Walker JW (1971) Pollen Morphology, Phytogeography, and Phylogeny of the Annonaceae. Contributions from the Gray Herbarium of Harvard University, 202: 1-130. Along with the other members of the genus, it serves as a host plant for zebra swallowtail butterfly and pawpaw sphinx mothFlorida Native Plant Society Asimina obovata in fruit

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asimina obovata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences6

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY584361.1 ↗441 bp

ACGT

GACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACC …

Asimina obovata voucher MO Abbott 24670 with Germain-Aubrey 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asimina obovata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Bowden 194Sa, 1948

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 490 records

Wild obs. + sensor1 360

Museum / vouchered130

Origin

Native1

Range

Area of Occupancy AOO2 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 689≤1 km 122≤10 km 40>10 km 128

979 georeferenced · 381 without coordinates

Open the mapobservation + sensor1 360

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 3≤10 km 7>10 km 17

27 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	51
Miami, US	19
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Bangkok, TH	8
Bronx, US	4
University of Stellenboschlocation not on record	3
Wuzhou, CN	2
Jena Microbial Resource Collectionlocation not on record	2
Western Carolina Universitylocation not on record	2
Dover, US	2
Mississippi State, US	1
Stockholm, SE	1
University of Southern Mississippilocation not on record	1
Chapel Hill, US	1
San Angelo, US	1
Saint Louis, US	1
Valdosta State Universitylocation not on record	1
Jackson, US	1
Bloomington, US	1

19 institutions · 113 of 130 vouchered records shown · 17 without an institution code

09Environmental DNA10 detections

Where the DNA of Asimina obovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 17.2–21.0

Seasonal swing summer↔winter12.3 °C

Max temp (day)21.6 °C 21.6–25.9

Min temp (night)13.5 °C 13.5–16.1

Precipitation126 mm/mo 126–167

Air humidity61.4 % 58.7–61.4

Moisture balance39.0 mm/mo 9.90–39.0

Vapour deficit754 Pa 754–1,021

Wind speed4.00 m/s 4.00–4.70

Cloud cover35.6 % 35.6–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asimina obovata

At a glance

Sources12 archives

Life cycle & reproduction3

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 490 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 490 records