Aseroe rubra

Labill. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Aseroe

At a glance

Occurrence records7 402

Data sources9

Biological traits0

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Aseroe rubra's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 402 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 402 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aseroe rubra, commonly known as the anemone stinkhorn, sea anemone fungus and starfish fungus, is a common and widespread basidiomycete fungus recognizable for its foul odour of carrion and its sea anemone shape when mature. Found in gardens on mulch and in grassy areas, it resembles a red star-shaped structure covered in brownish slime on a white stalk. It attracts flies, which spread its spores.http://www.gbif.net/occurrences/searchCountries.htm?c[0].s=20&c[0].p=0&c[0].o=14388305

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aseroe rubra has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMZ159348.1 ↗578 bpUnited Kingdom · 2004

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCTGAATTTATTTTCAAATCCCTTTCACACACCTGTGCACTCTAA …

Aseroe rubra voucher K(M):126758 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type7 402 records

Wild obs. + sensor7 054

Museum / vouchered327

Other21

Origin

Native6

Range

Area of Occupancy AOO16 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 3 264≤1 km 1 346≤10 km 596>10 km 433

5 639 georeferenced · 1 415 without coordinates

Open the mapobservation + sensor7 054

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 35≤1 km 48≤10 km 77>10 km 7

167 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence327

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	69
DPIlocation not on record	40
Durango, MX	24
Brisbane, AU	22
Museo Entomologico de Leonlocation not on record	19
Canberra, AU	11
National Biodiversity Institute, Costa Ricalocation not on record	7
Adelaide, AU	3
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Parkville, AU	3
Leicester, GB	3
QVMAGlocation not on record	2
Mexico City, MX	2
TENN-Flocation not on record	2
Schenectady, US	2
Hobart, AU	2
UFSClocation not on record	2
Toyota city nature sanctuarylocation not on record	1
Lake Charles, US	1
HAW-Flocation not on record	1
Kensington, AU	1
Chapel Hill, US	1
Uppsala, SE	1
Blacksburg, US	1
Bronx, US	1
Universidade Federale do Rio Grande do Sullocation not on record	1
Osaka, JP	1

27 institutions · 226 of 327 vouchered records shown · 101 without an institution code

09Environmental DNA1 detections

Where the DNA of Aseroe rubra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aseroe rubra

At a glance

Sources9 archives

At a glance

Record type7 402 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type7 402 records