Ascochyta sorghi

Sacc. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Didymellaceae/Ascochyta

At a glance

Occurrence records80

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Ascochyta sorghi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility80 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF80 records

DNA & barcodingNCBIsequences

01Narrative

Ascochyta sorghi is a fungal plant pathogen. It causes Ascochyta leaf spot (also known as rough leaf spot) on barley that can also be caused by the related fungi Ascochyta hordei, Ascochyta graminea and Ascochyta tritici. It is considered a minor disease of barley.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ascochyta sorghi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR551430.1 ↗496 bpChina · 2023

ACGT

GTAAGCGACTAGCCGGGAGCTATACTAGCTGCCGCCTGCACCCTTGCTTTTTGTGTACCCACTGTTTCCTCGGCGGTGCAAGCCGCCGGT …

Ascochyta sorghi isolate LZ-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor5

Museum / vouchered71

Cultivated / captive3

Other1

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 1≤10 km 7>10 km 6

14 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence71

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	30
Bernard Price Institute for Palaeontological Researchlocation not on record	16
Auckland, NZ	15
Bronx, US	2
DPIlocation not on record	2
TROMlocation not on record	1
Chicago, US	1
Champaign, US	1
Madison, US	1
Baton Rouge, US	1

10 institutions · 70 of 71 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)