Asclepias tuberosa

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records45 852

Data sources13

Biological traits105

DNA specimens18

eDNA detections13

Sources13 archives

Databases and archives Asclepias tuberosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 852 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources105 traits

Chemical compositionLOTUS · NPASS84 compounds

Occurrence & distributionGBIF45 852 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceCCDB557 Mbp

01Narrative

Asclepias tuberosa, communément appelée Asclépiade tubéreuse, est une espèce végétale de la famille des Apocynaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology5

Plant height0.61 m

⚠ sources differ — GIFT: 0.61 m · USDA: 0.61 m · TRY: 0.53 m

Plant height generative0.666 m

Seed mass3.91 mg

⚠ sources differ — TRY: 3.91 mg · GIFT: 6.62 mg

Seed mass max9.07 mg

Seed mass min5.27 mg

Life cycle & reproduction28

After harvest regrowth rateSlow

Bloom periodMid Summer

Coppice potentialNo

DeciduousnessN

Flower colourorange

Flower conspicuousYes

Flowering endJul

Flowering startJun

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDASlow

Life formperennial

Life spanperennial

Lifespan categoryModerate

Lifespan years9 years

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment25

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

Growth form USDAMultiple Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza typearbuscular

Root depth min16 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry25

Anaerobic toleranceNone

C:N ratioLow

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min135 days

Leaf C:N ratio118 g/g

Leaf c464 mg/g

Leaf dry-matter content (LDMC)224 mg/g

Leaf n23.76 mg/g

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max45 in

Precipitation min28 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceHigh

Soil pH max6.8 pH

Soil pH min4.8 pH

Specific leaf area (SLA)21.31 mm²/mg

Temperature min-33 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound70 000 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousYes

Fruit seed persistenceNo

Planting density max7 200 per acre

Planting density min3 450 per acre

03Chemical composition84 compounds

Compounds documented for Asclepias tuberosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pregnane steroids38

Cardenolides35

Cardenolides $ Pregnane steroids4

Androstane steroids1

Hydrocarbons $ Unsaturated fatty acids1

Documented compounds84 total

Compound	Amount	Source
(1S,2R,3'R,5'S,7'R,10'R,12'R,14'S,15'S,18'R,19'R,22'S,23'R)-10',22'-dihydroxy-7',18'-dimethyl-1,4-dioxo-19'-(5-oxo-2H-furan-3-yl)spiro[1,3-thiazolidine-2,9'-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacos-1(25)-ene]-14'-carbaldehyde	present	LOTUS
(1S,4S,6R,7R,9S,10R,12R,13S,15S,17R,18S)-7,15-dihydroxy-6-[(2S,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6R,7R,9S,10R,12R,13S,17R,18S)-7-hydroxy-6-[(2S,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,15S,17R,18S)-15-hydroxy-6-[(2R,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,15S,17R,18S)-15-hydroxy-6-[(2R,4R,5R,6R)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,15S,17R,18S)-15-hydroxy-6-[(2R,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,3S,4R,6R)-4-hydroxy-3-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,15S,17R,18S)-15-hydroxy-6-[(2R,4S,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,15S,17R,18S)-15-hydroxy-6-[(2R,4S,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,3S,4R,6R)-4-hydroxy-3-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,17R,18S)-6-[(2R,4R,5R,6R)-4-methoxy-5-[(2S,4S,5R,6R)-4-methoxy-5-[(2S,4R,5R,6R)-4-methoxy-5-[(2S,4R,5R,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS
(1S,4S,6S,9S,10R,12R,13S,17R,18S)-6-[(2R,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-9,13,18-trimethyl-19,20-dioxapentacyclo[10.7.1.01,10.04,9.013,17]icosan-14-one	present	LOTUS

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias tuberosa has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes6

GenBank sequences10

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL537304.1 ↗363 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATGGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACT …

Asclepias tuberosa voucher BRIT:Gostel422 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PmatK2rbcL6rbcLaITS2ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asclepias tuberosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size557 460 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Asclepias tuberosa0.56 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type45 852 records

Wild obs. + sensor42 569

Museum / vouchered3 247

Fossil1

Other35

Origin

Native12

Introduced3

Range

Area of Occupancy AOO94 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 27 228≤1 km 3 873≤10 km 1 617>10 km 2 543

35 261 georeferenced · 7 308 without coordinates

Open the mapobservation + sensor42 569

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 137≤1 km 479≤10 km 1 190>10 km 304

2 110 georeferenced · 1 137 without coordinates

Open the institutions mapphysical evidence3 247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions116 of 168 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	587
Chongqing Museumlocation not on record	233
Chicago, US	135
Bangkok, TH	118
Tampa, US	117
Jena Microbial Resource Collectionlocation not on record	113
Fort Worth, US	101
Austin, US	79
Allentown, US	73
Chapel Hill, US	73
New Brunswick, US	71
Ann Arbor, US	68
Saint Louis, US	56
College Park, US	53
New Haven, US	53
Bronx, US	51
Miami, US	48
University of Stellenboschlocation not on record	46
Williamsburg, US	44
McWane Science Centerlocation not on record	39
Albuquerque, US	38
Flagstaff, US	36
St. Paul, US	35
Tuscaloosa, US	33
Western Carolina Universitylocation not on record	32
Jackson, US	28
Denver, US	26
Appalachian State Universitylocation not on record	25
Lubbock, US	24
Madison, US	23
Logan, US	22
ASUlocation not on record	19
Burlington, US	19
GAlocation not on record	19
Ypsilanti, US	18
Emporia, US	18
Valdosta State Universitylocation not on record	17
Tall Timbers Research Stationlocation not on record	16
BAYLUlocation not on record	16
EL PASO, US	16
Staten Island, US	15
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	15
Dekalb, US	15
Norfolk, US	15
Green Bay, US	14
AUAlocation not on record	14
Columbia, US	14
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	14
US	13
Whitewater, US	12
Denton, US	12
Pittsburg, US	11
University of New Hampshirelocation not on record	11
Riverside, US	11
Davenport, US	11
Knoxville, US	10
San Angelo, US	10
Mexico City, MX	9
Millersville, US	9
Clemson, US	8
Bloomington, US	8
University of Southern Mississippilocation not on record	7
China Agricultural Universitylocation not on record	7
Cincinnati, US	7
University of Tennessee at Chattanoogalocation not on record	6
Provo, US	6
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Museum of the Rockieslocation not on record	6
Phoenix, US	6
Tennessee Technological Universitylocation not on record	6
USFSlocation not on record	6
Mississippi State, US	6
DOI/NPS, Colonial National Historical Parklocation not on record	5
Henderson State Universitylocation not on record	5
Chicago, US	5
Austin, US	5
US	5
Washington, US	4
Northridge, US	4
Chicago, US	4
Giardini Botanici Hanburylocation not on record	4
Claremont, US	4
Columbus State Universitylocation not on record	4
Toronto, CA	4
Dover, US	4
Conway, US	3
University of Wisconsinlocation not on record	3
Edmonton, CA	3
Boise, US	3
Conway, US	3
Philadelphia, US	3
Longwood Universitylocation not on record	3
Durango, MX	3
Fayetteville, US	3
San Jose, US	3
Santa Barbara, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Orem, US	3
Tempe, US	3
Science Museum of Minnesotalocation not on record	3
Kew, GB	2
Macomb, US	2
Davis, US	2
Fargo, US	2
Richmond, US	2
Waverly, US	2
Kingston, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Turlock, US	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
Los Angeles, US	2
Wuzhou, CN	2
Pullman, US	2
Linares, MX	2
University of Guelph, OAC Herbariumlocation not on record	2
Lincoln, US	2
Asheville, US	2
Armidale, AU	2
San Luis Obispo, US	2
Lord Fairfax Community Collegelocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Little Rock, US	1
Montréal, CA	1
Meguro Parasitological Museumlocation not on record	1
Fullerton, US	1
Johnson City, US	1
Stephenville, US	1
Moscow State Universitylocation not on record	1
Montréal, CA	1
West Virginia Wesleyan Collegelocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
San Francisco, US	1
Christchurch, NZ	1
Walla Walla, US	1
WTUlocation not on record	1
Kunming, CN	1
Angwin, US	1
US	1
Due West, US	1
Taipei, TW	1
Russellville, US	1
Harrisonburg, US	1
University of South Carolina Salkehatchielocation not on record	1
Paris, FR	1
Mexico City, MX	1
Fairfax, US	1
Elikins, US	1
DULlocation not on record	1
CONCOLlocation not on record	1
Cambridge, US	1
Hamilton, US	1
University of North Carolina at Pembrokelocation not on record	1
Oskarshamn, SE	1
Grand Junction, US	1
Odawara, JP	1
Nagano City, JP	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	1
Texas Lutheran Universitylocation not on record	1
Hudson, US	1
Oklahoma State Universitylocation not on record	1
Fredericksburg, US	1
WINlocation not on record	1
Mérida, MX	1
Hermosillo, MX	1
University of Alberta Museumslocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1

168 institutions · 3 147 of 3 247 vouchered records shown · 100 without an institution code

09Environmental DNA13 detections

Where the DNA of Asclepias tuberosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 21.8–26.4

Seasonal swing summer↔winter21.3 °C

Max temp (day)30.0 °C 24.8–31.9

Min temp (night)20.6 °C 17.6–21.6

Precipitation101 mm/mo 92.4–120

Air humidity58.3 % 57.3–59.3

Moisture balance-52.5 mm/mo -71.8–-40.8

Vapour deficit1,283 Pa 1,076–1,439

Wind speed2.50 m/s 2.10–3.80

Cloud cover34.3 % 31.0–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources13 archives

Size & morphology5

Life cycle & reproduction28

Diet & foraging1

Habitat & environment25

Physiology & chemistry25

Uses & economy15

Other traits6

Compound class profile5 classes

Documented compounds84 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type45 852 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions116 of 168 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type45 852 records