Asclepias tomentosa

Elliott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records760

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Asclepias tomentosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility760 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF760 records

DNA & barcodingNCBIsequences

01Narrative

Asclepias tomentosa là một loài thực vật có hoa trong họ La bố ma. Loài này được Elliott mô tả khoa học đầu tiên năm 1817.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias tomentosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627209.1 ↗561 bp

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACAAAAGATACT …

Asclepias tomentosa voucher FLAS:Majure 5116 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

08Occurrence & distribution

Record type760 records

Wild obs. + sensor616

Museum / vouchered144

Range

Area of Occupancy AOO1 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 268≤1 km 70≤10 km 28>10 km 127

493 georeferenced · 123 without coordinates

Open the mapobservation + sensor616

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 1≤1 km 12≤10 km 24>10 km 22

59 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	28
Tampa, US	22
Chicago, US	13
Chapel Hill, US	12
Miami, US	10
Philadelphia, US	7
Tall Timbers Research Stationlocation not on record	6
St. Paul, US	6
University of Stellenboschlocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Bronx, US	5
Fort Worth, US	5
Durham, US	4
Saint Louis, US	3
Wuzhou, CN	2
GAlocation not on record	2
Columbia, US	1
Mississippi State, US	1
Denton, US	1
Oklahoma State Universitylocation not on record	1
BAYLUlocation not on record	1

21 institutions · 141 of 144 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)