Asclepias sullivantii

Engelm. ex A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records1 488

Data sources10

Biological traits17

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Asclepias sullivantii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 488 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Asclepias sullivantii là một loài thực vật có hoa trong họ La bố ma. Loài này được Engelm. ex A.Gray mô tả khoa học đầu tiên năm 1848.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.7 mg

Seed mass max4.7 mg

Seed mass min4.7 mg

Life cycle & reproduction4

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf c391 mg/g

Leaf n24.09 mg/g

Specific leaf area (SLA)13.41 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias sullivantii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG219355.1 ↗364 bpCanada · 1958

ACGT

TGCAGAATCCCGTGAACCATGGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACT …

Asclepias sullivantii voucher 28247HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asclepias sullivantii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 488 records

Wild obs. + sensor1 185

Museum / vouchered303

Range

Area of Occupancy AOO3 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 627≤1 km 111≤10 km 35>10 km 264

1 037 georeferenced · 148 without coordinates

Open the mapobservation + sensor1 185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 22≤1 km 60≤10 km 97>10 km 33

212 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	87
Chicago, US	66
Bloomington, US	22
Saint Louis, US	12
Philadelphia, US	12
Emporia, US	11
Madison, US	11
Chadron, US	11
Bronx, US	9
Lincoln, US	7
Pittsburg, US	4
Chongqing Museumlocation not on record	4
University of Stellenboschlocation not on record	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Chicago, US	2
US	2
Denver, US	2
Tampa, US	2
Dekalb, US	2
Davenport, US	2
University of Guelph, OAC Herbariumlocation not on record	2
Bangkok, TH	2
Toronto, CA	2
Fort Worth, US	2
Columbia, US	1
Kirksville, US	1
Moscow, US	1
Museum of the Rockieslocation not on record	1
Clemson, US	1
Fargo, US	1
Whitewater, US	1
Oklahoma State Universitylocation not on record	1
Burlington, US	1
Edmonton, CA	1
Turlock, US	1
Austin, US	1
Mississippi State, US	1

37 institutions · 296 of 303 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Asclepias sullivantii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 22.4–23.4

Seasonal swing summer↔winter27.1 °C

Max temp (day)26.3 °C

Min temp (night)20.2 °C 19.1–21.3

Precipitation95.1 mm/mo 92.6–97.6

Air humidity58.4 % 58.3–58.4

Moisture balance-81.1 mm/mo -83.6–-78.6

Vapour deficit1,164 Pa 1,128–1,199

Wind speed3.60 m/s 3.60–3.70

Cloud cover36.7 % 36.1–37.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asclepias sullivantii

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 488 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions31 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 488 records