Asclepias stenophylla

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records1 128

Data sources7

Biological traits8

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Asclepias stenophylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 128 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF1 128 records

DNA & barcodingNCBIsequences

01Narrative

Asclepias stenophylla is a species of flowering plant in the dogbane family (Apocynaceae) commonly called slimleaf milkweed and narrow-leaved green milkweed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Physiology & chemistry3

Leaf c422 mg/g

Leaf n21.89 mg/g

Specific leaf area (SLA)11.27 mm²/mg

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias stenophylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMG678829.1 ↗132 378 bp

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCGCTGGTTCTATTT …

Asclepias stenophylla voucher OKLA:Fishbein 7509 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type1 128 records

Wild obs. + sensor691

Museum / vouchered437

Range

Area of Occupancy AOO2 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 274≤1 km 58≤10 km 19>10 km 104

455 georeferenced · 236 without coordinates

Open the mapobservation + sensor691

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 26≤1 km 95≤10 km 121>10 km 42

284 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	177
Chicago, US	35
Chadron, US	34
Saint Louis, US	30
Bronx, US	26
Lincoln, US	23
Spearfish, US	15
Emporia, US	15
DOI/NPS, Colonial National Historical Parklocation not on record	13
Fort Worth, US	11
Philadelphia, US	7
Missoula, US	6
Brookings, US	3
Edmonton, CA	3
Bozeman, US	3
Austin, US	3
Denver, US	3
Madison, US	2
Musee des Dinosaures d'Esperaza (Aude)location not on record	2
Pittsburg, US	2
EL PASO, US	2
Flagstaff, US	2
Logan, US	2
Chongqing Museumlocation not on record	2
University of Stellenboschlocation not on record	1
Lubbock, US	1
Riverside, US	1
FLASlocation not on record	1
Tempe, US	1
Bloomington, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Chapel Hill, US	1
Denton, US	1
Turlock, US	1
Dekalb, US	1
Claremont, US	1
BAYLUlocation not on record	1
Oklahoma State Universitylocation not on record	1

38 institutions · 435 of 437 vouchered records shown · 2 without an institution code

At a glance

Sources7 archives

Life cycle & reproduction2

Habitat & environment3

Physiology & chemistry3

At a glance

Record type1 128 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 38 geolocated

Record type1 128 records