Asclepias solanoana

Woodson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records298

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Asclepias solanoana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility298 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF298 records

DNA & barcodingNCBIsequences

01Narrative

Asclepias solanoana is a rare species of milkweed known by the common names serpentine milkweed, prostrate milkweed, and solanoa. It is endemic to California, where it grows only in the North Coast Ranges north of the San Francisco Bay Area.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias solanoana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMG678897.1 ↗132 753 bp

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCGCTGGTTCTATTT …

Asclepias solanoana voucher OKLA:Lynch 10884 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type298 records

Wild obs. + sensor157

Museum / vouchered141

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 155

155 georeferenced · 2 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 47≤10 km 14>10 km 1

67 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	48
Arcata, US	24
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	17
STNFlocation not on record	6
Davis, US	5
Claremont, US	4
CASlocation not on record	3
Santa Barbara, US	3
Logan, US	2
Chicago, US	2
Fort Worth, US	2
Paris, FR	1
Fredericton Stock Culture Collectionlocation not on record	1
Riverside, US	1
Canadian Department of Agriculturelocation not on record	1
Chongqing Museumlocation not on record	1
Corvallis, US	1
Bangkok, TH	1

18 institutions · 123 of 141 vouchered records shown · 18 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)