Asclepias obovata

Elliott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records670

Data sources7

Biological traits9

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Asclepias obovata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility670 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF670 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Asclepias obovata là một loài thực vật có hoa trong họ La bố ma. Loài này được Elliott mô tả khoa học đầu tiên năm 1817.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias obovata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG678824.1 ↗131 975 bp

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCGCTGGTTCTATTT …

Asclepias obovata voucher OKLA:Fishbein 7203 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type670 records

Wild obs. + sensor544

Museum / vouchered126

Range

Area of Occupancy AOO1 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 209≤1 km 45≤10 km 17>10 km 150

421 georeferenced · 123 without coordinates

Open the mapobservation + sensor544

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 6≤1 km 12≤10 km 23>10 km 7

48 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	14
Jackson, US	13
Valdosta State Universitylocation not on record	8
Little Rock, US	8
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	7
Austin, US	6
US	5
Wuzhou, CN	5
University of Southern Mississippilocation not on record	5
Chongqing Museumlocation not on record	4
Fort Worth, US	4
University of South Carolina Salkehatchielocation not on record	4
Philadelphia, US	4
AUAlocation not on record	4
Tall Timbers Research Stationlocation not on record	3
Saint Louis, US	3
Mississippi State, US	3
Tuscaloosa, US	3
Bronx, US	3
GAlocation not on record	2
EL PASO, US	2
Chicago, US	2
Columbia, US	2
Bangkok, TH	2
Miami, US	1
Asheville, US	1
Henderson State Universitylocation not on record	1
Tampa, US	1
Edmonton, CA	1
Knoxville, US	1
Chapel Hill, US	1
Denver, US	1
Columbus State Universitylocation not on record	1

33 institutions · 125 of 126 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Asclepias obovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter20.2 °C

Max temp (day)30.0 °C

Min temp (night)20.0 °C

Precipitation83.4 mm/mo

Air humidity57.5 %

Moisture balance-40.2 mm/mo

Vapour deficit1,283 Pa

Wind speed2.30 m/s

Cloud cover28.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)