Asclepias latifolia

(Torr.) Raf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records3 910

Data sources9

Biological traits9

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Asclepias latifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 910 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF3 910 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Asclepias latifolia là một loài thực vật có hoa trong họ La bố ma. Loài này được (Torr.) Raf. mô tả khoa học đầu tiên năm 1832.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Asclepias latifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Oleanane triterpenoids2

Stigmastane steroids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,4aR,6aR,6bS,8aR,12aS,14aR,14bR)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-ol	present	LOTUS
(3R,8R,9R,10S,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
[(3R,4aR,6aR,6bS,8aR,12aS,14aR,14bR)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl] acetate	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias latifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMG678868.1 ↗133 465 bp

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCGCTGGTTCTATTT …

Asclepias latifolia voucher Fishbein 6597 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Asclepias latifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Moyer

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 910 records

Wild obs. + sensor3 446

Museum / vouchered464

Range

Area of Occupancy AOO7 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 951≤1 km 221≤10 km 96>10 km 169

2 437 georeferenced · 1 009 without coordinates

Open the mapobservation + sensor3 446

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 11≤1 km 94≤10 km 137>10 km 37

279 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence464

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	90
Bronx, US	51
Albuquerque, US	42
Flagstaff, US	38
DOI/NPS, Greenbelt Parklocation not on record	34
Lubbock, US	28
DOI/NPS, Colonial National Historical Parklocation not on record	21
ASUlocation not on record	16
Phoenix, US	16
Chicago, US	14
Fort Worth, US	13
Provo, US	11
Austin, US	10
Denver, US	10
EL PASO, US	10
Musee des Dinosaures d'Esperaza (Aude)location not on record	9
Logan, US	7
Philadelphia, US	6
Chadron, US	4
Claremont, US	3
USFSlocation not on record	3
Pullman, US	3
Orem, US	3
Saint Louis, US	3
Burlington, US	2
University of Stellenboschlocation not on record	2
Emporia, US	2
Staten Island, US	2
San Angelo, US	1
Denton, US	1
Mexico City, MX	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Lincoln, US	1
KANUlocation not on record	1
MAlocation not on record	1
Mississippi State, US	1
Pomona Collegelocation not on record	1

37 institutions · 462 of 464 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asclepias latifolia

At a glance

Sources9 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

Compound class profile2 classes

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 910 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 37 geolocated

Record type3 910 records