Asclepias incarnata
speciesAt a glance
Occurrence records32 700
Data sources15
Biological traits103
DNA specimens18
eDNA detections13
Sources15 archives
Databases and archives Asclepias incarnata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility32 700 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources103 traits
Chemical compositionLOTUS · NPASS106 compounds
Occurrence & distributionGBIF32 700 records
Environmental DNA1 datasets · 2 countries13 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceCCDB · GoaT · NCBI342 Mbp
01Narrative
Asclepias incarnata, communément appelée Asclépiade rouge, Asclépiade incarnate et Asclépiade des marais, est une espèce de plante herbacée vivace du genre Asclepias native d'Amérique du Nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology6
Leaf size1 052 mm²
Plant height1.5 m
⚠ sources differ — GIFT: 1.5 m · USDA: 1.49 m · TRY: 0.964 m
Plant height generative1.09 m
Seed mass3.6 mg
⚠ sources differ — TRY: 3.6 mg · GIFT: 3.3 mg
Seed mass max4.4 mg
Seed mass min2.95 mg
Life cycle & reproduction26
After harvest regrowth rateSlow
Bloom periodFall
Coppice potentialNo
Flower colourred
Flower conspicuousYes
Flowering endAug
Flowering startJul
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min18 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementMedium
Fire resistantYes
Fire toleranceLow
Frost free days min107 days
Leaf C:N ratio36.66 g/g
Leaf c430 mg/g
Leaf dry-matter content (LDMC)203 mg/g
Leaf n13.77 mg/g
Leaf p2.3 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min15 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8 pH
Soil pH min5 pH
Specific leaf area (SLA)27.85 mm²/mg
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound153 761 per lb
ToxicityModerate
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max7 200 per acre
Planting density min3 450 per acre
03Chemical composition106 compounds
Compounds documented for Asclepias incarnata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pregnane steroids101
Cardenolides3
Polysaccharides1
Phenylethanoids1
Simple coumarins1
Documented compounds106 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 1-(3,8,12,14-tetrahydroxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl)ethanone | present | LOTUS | |
| 1-[(3R,8R,9R,10R,12R,13S,14S,17R)-8,12,14-trihydroxy-3-[(2S,4R,5R,6S)-4-hydroxy-5-[(2R,4S,5R,6R)-4-hydroxy-5-[(2R,4S,5S,6R)-4-hydroxy-5-[(2R,4R,5S,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3R,8R,9R,10R,12R,13S,14S,17S)-8,12,14-trihydroxy-3-[(2R,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3R,8R,9R,10R,12R,13S,14S,17S)-8,12,14-trihydroxy-3-[(2R,4R,5R,6R)-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-4-methoxy-6-methyl-5-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3R,8R,9R,10R,12R,13S,14S,17S)-8,12,14-trihydroxy-3-[(2R,4R,5R,6R)-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3R,8S,9S,10R,12R,13S,14S,15R,17R)-8,12,14,15-tetrahydroxy-3-[(2R,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3R,8S,9S,10R,12R,13S,14S,15R,17R)-8,12,14,15-tetrahydroxy-3-[(2R,4R,5R,6R)-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3S,8R,9R,10R,12R,13R,14R,17R)-8,12,14-trihydroxy-3-[(2S,4S,5S,6R)-4-hydroxy-5-[(2R,4R,5R,6S)-4-hydroxy-5-[(2S,4S,5R,6S)-4-hydroxy-5-[(2R,4S,5R,6R)-4-methoxy-6-methyl-5-[(2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3S,8R,9R,10R,12S,13S,14S,17R)-8,12,14,17-tetrahydroxy-3-[(2S,4S,5S,6S)-4-hydroxy-5-[(2R,4R,5R,6S)-4-hydroxy-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-1,2,3,4,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS | |
| 1-[(3S,8S,9R,10R,12R,13S,14R,16R,17R)-8,12,14,16-tetrahydroxy-3-[(2R,4R,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | LOTUS |
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias incarnata has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes7
GenBank sequences10
eDNA detections13
Countries2
The DNA barcodea real sequence read deposited for this species
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCAAATCCTCGTACCGAATGACCGCGAACGCGTTCCGAAACAAA …
Asclepias incarnata voucher Beyersdorfer 186 US 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Asclepias incarnata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size342 300 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Asclepias incarnata0.34 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records22–222n range22median22mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 223×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Kapoor, B. M., S. Ramcharitar & C. Gervais. 1987. Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amérique. Naturaliste Canad. 114: 105–116.
CCDB · book-atlas-flowering-plants — HTRu
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type32 700 records
Wild obs. + sensor30 014
Museum / vouchered2 664
Cultivated / captive20
Other2
Origin
Native16
Introduced6
Range
Area of Occupancy AOO73 224 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 18 680≤1 km 3 364≤10 km 1 086>10 km 1 744
24 874 georeferenced · 5 140 without coordinates
Open the mapobservation + sensor30 014
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 122≤1 km 418≤10 km 878>10 km 154
1 572 georeferenced · 1 092 without coordinates
Open the institutions mapphysical evidence2 664
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy40% within 1 km
≤1 km 4≤10 km 6
10 georeferenced · 10 without coordinates
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions98 of 146 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 371 |
| Chicago, US | 189 |
| Chongqing Museumlocation not on record | 171 |
| Bronx, US | 136 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 106 |
| St. Paul, US | 105 |
| Ann Arbor, US | 90 |
| Burlington, US | 59 |
| University of Stellenboschlocation not on record | 53 |
| Tampa, US | 52 |
| Chapel Hill, US | 51 |
| Allentown, US | 50 |
| Québec, CA | 48 |
| New Haven, US | 48 |
| Green Bay, US | 47 |
| College Park, US | 38 |
| Acadia Universitylocation not on record | 37 |
| University of Wisconsinlocation not on record | 34 |
| WINlocation not on record | 31 |
| McWane Science Centerlocation not on record | 28 |
| Madison, US | 28 |
| Toronto, CA | 25 |
| Lincoln, US | 25 |
| Fort Worth, US | 25 |
| Logan, US | 25 |
| Denver, US | 24 |
| University of New Hampshirelocation not on record | 23 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 23 |
| Millersville, US | 22 |
| Staten Island, US | 21 |
| Saint John, CA | 20 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 20 |
| Bangkok, TH | 20 |
| Spearfish, US | 18 |
| Whitewater, US | 18 |
| Williamsburg, US | 17 |
| Ypsilanti, US | 17 |
| Miami, US | 17 |
| Pittsburg, US | 17 |
| Dekalb, US | 16 |
| Davenport, US | 16 |
| Emporia, US | 15 |
| Austin, US | 14 |
| Chicago, US | 14 |
| Montréal, CA | 13 |
| Université Lavallocation not on record | 13 |
| Flagstaff, US | 11 |
| Cincinnati, US | 11 |
| Museum of the Rockieslocation not on record | 9 |
| Appalachian State Universitylocation not on record | 8 |
| Jena Microbial Resource Collectionlocation not on record | 8 |
| Chicago, US | 8 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| Durango, MX | 7 |
| Weber State Universitylocation not on record | 7 |
| Saint Louis, US | 6 |
| Dover, US | 6 |
| Norfolk, US | 6 |
| Albuquerque, US | 6 |
| Keene State Universitylocation not on record | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| New Brunswick, US | 5 |
| Orem, US | 5 |
| Columbia, US | 5 |
| Riverside, US | 5 |
| Mount Pleasant, US | 5 |
| Waverly, US | 5 |
| US | 5 |
| WTUlocation not on record | 4 |
| Science Museum of Minnesotalocation not on record | 4 |
| Hamilton, US | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Kingston, US | 4 |
| Brookings, US | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Paris, FR | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Boise, US | 3 |
| Clemson, US | 3 |
| Pomona Collegelocation not on record | 3 |
| Richmond, US | 3 |
| Chadron, US | 3 |
| Lubbock, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Knoxville, US | 3 |
| Bozeman, US | 3 |
| Oswego, US | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Bandelier National Monumentlocation not on record | 2 |
| Washington, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| AUAlocation not on record | 2 |
| Hudson, US | 2 |
| Beijing, CN | 2 |
| Edmonton, CA | 2 |
| San Angelo, US | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Durham, US | 2 |
| Mississippi State, US | 2 |
| Long Beach, US | 2 |
| Fairfax, US | 2 |
| West Virginia Wesleyan Collegelocation not on record | 2 |
| Provo, US | 2 |
| Fargo, US | 2 |
| Moscow, US | 2 |
| San Jose, US | 2 |
| Mexico City, MX | 2 |
| ASUlocation not on record | 2 |
| Columbus State Universitylocation not on record | 2 |
| Nijmegen, NL | 2 |
| Claremont, US | 2 |
| GAlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Pondicherry, IN | 1 |
| University of Louisiana at Monroelocation not on record | 1 |
| Phoenix, US | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| EL PASO, US | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Pullman, US | 1 |
| Oskarshamn, SE | 1 |
| US | 1 |
| Cheney, US | 1 |
| Caldwell, US | 1 |
| Northridge, US | 1 |
| Russellville, US | 1 |
| Macomb, US | 1 |
| Auckland, NZ | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| VALElocation not on record | 1 |
| Montréal, CA | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Moscow State Universitylocation not on record | 1 |
| Turlock, US | 1 |
| Trois-Rivières, CA | 1 |
| Stephenville, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Harrisonburg, US | 1 |
| Wuzhou, CN | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Davis, US | 1 |
146 institutions · 2 545 of 2 664 vouchered records shown · 119 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Asclepias incarnata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.1 °C 17.2–25.6
Seasonal swing summer↔winter27.0 °C
Max temp (day)26.1 °C 20.2–31.2
Min temp (night)19.0 °C 14.4–20.9
Precipitation102 mm/mo 73.7–115
Air humidity58.8 % 57.4–61.2
Moisture balance-71.7 mm/mo -82.5–-52.5
Vapour deficit1,113 Pa 815–1,336
Wind speed3.40 m/s 2.50–5.20
Cloud cover38.2 % 33.1–42.3
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.