Asclepias feayi

Chapm. ex A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records584

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Asclepias feayi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility584 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF584 records

DNA & barcodingNCBIsequences

01Narrative

Asclepias feayi is a species of milkweed endemic to Florida. Its common name is Florida milkweed. It is in the family Apocynaceae. Glyphodes floridalis is a species of moth known as the Florida milkweed vine moth.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias feayi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMG678855.1 ↗132 862 bp

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCGCTGGTTCTATTT …

Asclepias feayi voucher MISSA:Fishbein 5586 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type584 records

Wild obs. + sensor497

Museum / vouchered87

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 312≤1 km 55≤10 km 21>10 km 40

428 georeferenced · 69 without coordinates

Open the mapobservation + sensor497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 4≤10 km 13>10 km 18

35 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	33
St. Paul, US	11
Chicago, US	10
Jena Microbial Resource Collectionlocation not on record	6
Philadelphia, US	6
Miami, US	5
Bronx, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Chapel Hill, US	2
Bloomington, US	2
University of Southern Mississippilocation not on record	1
Chongqing Museumlocation not on record	1
Bangkok, TH	1
Saint Louis, US	1
Madison, US	1

15 institutions · 85 of 87 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)