Asclepias engelmanniana

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records1 192

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Asclepias engelmanniana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 192 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 192 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Asclepias engelmanniana là một loài thực vật có hoa trong họ La bố ma. Loài này được Woodson mô tả khoa học đầu tiên năm 1941.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias engelmanniana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMG678852.1 ↗133 531 bp

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCGCTGGTTCTATTT …

Asclepias engelmanniana voucher OKLA:Lynch 11029 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Asclepias engelmanniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — NIEHAUS, T., & L. WONG, JR. 1971. In IOPB chromosome reports XXXII. Taxon 20: 3Q9-356.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 192 records

Wild obs. + sensor708

Museum / vouchered482

Other2

Range

Area of Occupancy AOO3 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 400≤1 km 63≤10 km 23>10 km 50

536 georeferenced · 172 without coordinates

Open the mapobservation + sensor708

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 20≤1 km 81≤10 km 160>10 km 53

314 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence482

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	123
Bronx, US	48
Fort Worth, US	31
DOI/NPS, Colonial National Historical Parklocation not on record	27
Austin, US	27
Lubbock, US	26
Albuquerque, US	25
DOI/NPS, Greenbelt Parklocation not on record	21
Musee des Dinosaures d'Esperaza (Aude)location not on record	18
Chicago, US	14
Chadron, US	13
ASUlocation not on record	13
Denver, US	10
Philadelphia, US	9
Flagstaff, US	9
Emporia, US	8
Saint Louis, US	8
Phoenix, US	6
Lincoln, US	6
Chongqing Museumlocation not on record	4
San Angelo, US	4
Claremont, US	3
Pomona Collegelocation not on record	3
Austin, US	2
Williamsburg, US	2
KANUlocation not on record	2
BAYLUlocation not on record	2
Tampa, US	2
Pittsburg, US	2
EL PASO, US	2
Burlington, US	2
Stephenville, US	1
Mexico City, MX	1
Bangkok, TH	1
Durango, US	1
Madison, US	1
GB	1
Logan, US	1
Tempe, US	1

39 institutions · 480 of 482 vouchered records shown · 2 without an institution code

At a glance

Sources8 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 192 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions31 of 39 geolocated

Record type1 192 records