Asclepias curtissii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records506

Data sources6

Biological traits9

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Asclepias curtissii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility506 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF506 records

DNA & barcodingNCBIsequences

01Narrative

Asclepias curtissii, or Curtiss's milkweed, is a rare species of flowering milkweed that is endemic to Florida's sandy areas. Curtiss's milkweed belongs to the subfamily Asclepiadoideae and the genus Asclepias. This dicotyledonous, perennial plant was placed on the endangered species list by the state of Florida to protect this rare milkweed. Although Curtiss milkweed is found all over Florida, the populations are very isolated and concentrated.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias curtissii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

rbcLKX397701.1 ↗516 bp

ACGT

TTGACTTATTATACTCCTGAATACGAAACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAA …

Asclepias curtissii voucher Orzell 23705 (FLAS) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2

plant barcode

08Occurrence & distribution

Record type506 records

Wild obs. + sensor488

Museum / vouchered18

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 6≤1 km 8≤10 km 2>10 km 469

485 georeferenced · 3 without coordinates

Open the mapobservation + sensor488

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 9

11 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	9
Jena Microbial Resource Collectionlocation not on record	4
Chicago, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Tampa, US	1

5 institutions · 17 of 18 vouchered records shown · 1 without an institution code