Asclepias albens

(E.Mey.) Schltr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Asclepias

At a glance

Occurrence records510

Data sources6

Biological traits14

DNA specimens5

eDNA detections3

Sources6 archives

Databases and archives Asclepias albens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility510 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF510 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Asclepias albens là một loài thực vật có hoa trong họ La bố ma. Loài này được (E.Mey.) Schltr. mô tả khoa học đầu tiên năm 1896.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.2 m

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 700 m

Elevation min10 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asclepias albens has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAM396879.1 ↗647 bpSouth Africa

ACGT

CGGAAGGATCATTGTCAAATCCTTGCAACCGAATGACCCGCGAACGCGTTCCGAAAACGAAGAAGCGCAGCCGCGCCCTTGCTCGGTCGG …

Asclepias albens 18S rRNA gene (partial), 5.8S rRNA gene, 5S rRNA gene (partial), ITS1 and ITS2, specimen voucher Nicholas 2813 (UDW)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type510 records

Wild obs. + sensor259

Museum / vouchered251

Range

Area of Occupancy AOO1 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 159≤1 km 43≤10 km 10>10 km 12

224 georeferenced · 35 without coordinates

Open the mapobservation + sensor259

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 2>10 km 2

5 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	152
Durban, ZA	66
Cape Town, ZA	18
Cape Town, ZA	5
Pretoria National Herbariumlocation not on record	2
MeiseBGlocation not on record	2
GZUlocation not on record	2
Kew, GB	1
Saint Louis, US	1
St. Paul, US	1

10 institutions · 250 of 251 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Asclepias albens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 18.9–21.7

Seasonal swing summer↔winter10.2 °C

Max temp (day)25.8 °C 24.8–26.4

Min temp (night)13.2 °C 12.0–17.5

Precipitation103 mm/mo 48.3–106

Air humidity56.0 % 49.8–65.5

Moisture balance-48.9 mm/mo -88.7–-29.5

Vapour deficit982 Pa 889–1,145

Wind speed2.90 m/s 2.90–3.30

Cloud cover32.9 % 19.6–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)