Asarum splendens

(F.Maek.) C.Y.Cheng & C.S.Yang · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Asarum

At a glance

Occurrence records48

Data sources11

Biological traits9

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Asarum splendens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Asarum splendens, the Chinese wild ginger or showy Sichuan ginger, is a species of wild ginger.Armitage (2008) Herbaceous Perennial Plants: A Treatise on Their Identification, Culture, and Garden Attributes (3rd edn.) Stipes publishing, Champaigne, p.144.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max1 300 m

Elevation mean1 075 m

Elevation min850 m

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Asarum splendens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Neolignans1

Stigmastane steroids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Class	Amount	Source
beta-Sitosterol		present	LOTUS
Isoasatone A		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asarum splendens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM092239.1 ↗226 bp

ACGT

TGCTATGCGTCGCTCCCACATCCATCTCGGATATAGGACGCGGAGATTGGCTATCCGTTCAAATCCTTGCGCGGTTTGCCTAAAATTTGG …

Asarum splendens voucher YC0623MT03 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asarum splendens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kondo, K., H. Na, Z. Gu, Q. Fan & L. Xia. 1987. A karyomorphological study in four species of Asarum from Yunnan, China. Kromosomo 46: 1495–1501.

2n 391×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sugawara, T. & M. Ogisu. 1992. Karyomorphology of 11 species of Asarum (Aristolochiaceae) from Taiwan and mainland China. Acta Phytotax. Geobot. 43: 89–96.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type48 records

Wild obs. + sensor9

Museum / vouchered37

Cultivated / captive2

Origin

Introduced2

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 6≤1 km 1>10 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence37

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Seoul, KR	8
Ischia Marine Centrelocation not on record	7
EMTCMlocation not on record	5
重庆市药物种植研究所药用植物标本馆location not on record	5
Kunming, CN	2
Cambridge, US	2
Kew, GB	2
Chengdu, CN	2
Uppsala, SE	2
Taipei, TW	1
Saint Louis, US	1

11 institutions · 37 of 37 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Asarum splendens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)