Asarum monodoriflorum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Asarum

At a glance

Occurrence records2

Data sources8

Biological traits4

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Asarum monodoriflorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Asarum monodoriflorum, also known by the common name Monodora-kan-aoi, is a low-growing, herbaceous perennial plant. It is critically endangered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asarum monodoriflorum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC004522.1 ↗637 bp

ACGT

TCGATGCCTATCAATCAGATTGACCATGCGAACTTGTGATGCCCAACTATCGGGGGCGGCGTTCAACCAACCCCGTCCCTCTGCGCTGCG …

Asarum monodoriflorum genes for ITS1, 5.8S rRNA, ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL1ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	1
Nishihara, JP	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Asarum monodoriflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.