Asarum asperum

F.Maek. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Asarum

At a glance

Occurrence records23

Data sources11

Biological traits4

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Asarum asperum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Asarum asperum is a species of flowering plant in the pipevine family, Aristolochiaceae. It is endemic to Japan, where it is found on Shikoku and in the western regions of Honshu. It is particularly common in the vicinity of Kyoto and Nara. It is a perennial that produces thick evergreen leaves, which are ovate-orbicular and have a subhastate base. It produces ground-level maroon flowers, that are pollinated by insects. The flowering tube is prominently constricted at its apex. It blooms in April. It forms colonies on the forest floor, where it often grows co-occurs with Ainsliaea cordifolia, with which it bears a resemblance. Detail of flowers

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition8 compounds

Compounds documented for Asarum asperum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Naphthoquinones6

Bisnaphthalenes $ Naphthoquinones1

Naphthalenes and derivatives $ Naphthoquinones1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4S)-4,8-dihydroxy-3-methyl-tetralin-1-one	present	NPASS
5,6-Dihydroxy-2-methylnaphthalene-1,4-dione	present	NPASS
5-Hydroxy-3-methoxy-2-methylnaphthalene-1,4-dione	present	NPASS
5-Hydroxy-6-(4-hydroxy-1-methyl-5,8-dioxo-6,7-dihydronaphthalen-2-yl)-2-methylnaphthalene-1,4-dione	present	NPASS
Chitranone	present	NPASS
Isoplumbagolone	present	NPASS
Maritinone	present	NPASS
Plumbagin	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asarum asperum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC530392.1 ↗655 bpJapan

ACGT

GATCATTGTCGATGCCTATCAATCAGATTGACCATGCGAACTTGTGATGCCCAACTACTATCGGGGGCGGTGTTCAACCAACCCCGTCCC …

Asarum asperum TBG160697 gene for ITS1, 5.8S rRNA, and ITS2, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asarum asperum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Sugawara, T. 1981. Taxonomic studies of Asarum sensu lato 1. Karyotype and C-banding pattern in Asarum s. str., Asiasarum and Heterotropa. Bot. Mag. (Tokyo) 94: 225–238.

CCDB · ipcn-api-dl — Na, H., M. Segawa & K. Kondo. 1988. A population study in Asarum hexalobum and A. asperum with special reference to karyotype variation. Kromosomo 50: 1628–1634.

CCDB · book-fedorov — Tanaka N. 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type23 records

Wild obs. + sensor3

Museum / vouchered20

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KURAlocation not on record	12
Toyama, JP	3
Toyota city nature sanctuarylocation not on record	2
Otaru, JP	1
Kochi, JP	1
Sendai, JP	1

6 institutions · 20 of 20 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Asarum asperum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)