Arytera divaricata

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Arytera

At a glance

Occurrence records1 720

Data sources9

Biological traits43

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Arytera divaricata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 720 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF1 720 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Arytera divaricata, known as the gap axe, coogara, coogera or rose tamarind is a forest tree of eastern Australia. An attractive plant with glossy pale and limp new leaves. It grows in fairly dry situations, often in littoral rainforests and monsoon forest. The southernmost limit of natural distribution Port Stephens (32° S) in New South Wales, extending north to Cape York at the northernmost tip of Australia. The generic name Arytera is from the Greek for cup. The fruit valves are of a cup shape. divaricata from the Latin which refers to the wide spreading branchlets of the flower panicle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length13 mm

Fruit width11 mm

Leaf length100 mm

Leaf length max200 mm

Leaf length min70 mm

Leaf mass per area84.74 g/m2

Leaf size3 100 mm²

⚠ sources differ — TRY: 3 100 mm² · AusTraits: 4 400 mm²

Leaf width45 mm

Leaf width max60 mm

Leaf width min15 mm

Petiole length3.5 cm

Plant height30 m

Plant height max30 m

Seed length12.5 mm

Seed mass59.7 mg

⚠ sources differ — TRY: 59.7 mg · AusTraits: 225 mg · GIFT: 59.7 mg

Seed mass max59.7 mg

Seed mass min59.7 mg

Seed width6 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timeyyyyynnnnnyy

Life formtree

Life spanperennial

Pollination syndromebee

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical oblong obovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.47 mm²/mg

Wood density633 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arytera divaricata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896095.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Arytera divaricata voucher 129307797 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type1 720 records

Wild obs. + sensor711

Museum / vouchered634

Cultivated / captive3

Other372

Origin

Native55

Range

Area of Occupancy AOO3 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 581≤1 km 39≤10 km 24>10 km 9

653 georeferenced · 58 without coordinates

Open the mapobservation + sensor711

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 82≤1 km 29≤10 km 228>10 km 62

401 georeferenced · 233 without coordinates

Open the institutions mapphysical evidence634

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	215
Smithfield, AU	144
Museo Entomologico de Leonlocation not on record	83
Mount Annan, AU	51
Canberra, AU	23
Armidale, AU	21
Kew, GB	13
Palmerston, AU	11
Saint Louis, US	9
Honolulu, US	6
James Cook Townsvillelocation not on record	4
Adelaide, AU	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Paris, FR	1
Hobart, AU	1

16 institutions · 589 of 634 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Arytera divaricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 16.0–18.1

Seasonal swing summer↔winter11.1 °C

Max temp (day)22.1 °C 21.4–22.8

Min temp (night)12.7 °C 11.4–14.0

Precipitation112 mm/mo 95.5–128

Air humidity60.4 % 60.0–60.9

Moisture balance-0.5 mm/mo -11.7–10.8

Vapour deficit776 Pa 737–814

Wind speed2.40 m/s 1.90–2.90

Cloud cover24.4 % 23.3–25.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arytera divaricata

At a glance

Sources9 archives

Size & morphology18

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

At a glance

Record type1 720 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 720 records