Arytera distylis

(Benth.) Radlk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Arytera

At a glance

Occurrence records699

Data sources8

Biological traits35

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Arytera distylis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility699 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF699 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Arytera distylis, known as the two-leaved coogera or twin-leaved coogera is a rainforest tree of eastern Australia. It grows by streams or in sea side rainforests. It occurs from the Orara River in the Mid North Coast region of New South Wales, extending up to Maryborough in south east Queensland. The twin leaf foliage makes identification of this plant fairly straightforward. The generic name Arytera is from the Ancient Greek for '"cup". The fruit valves are of a cup shape. distylis from the Latin which refers to the two styles in the flower.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology15

Fruit length11.5 mm

Fruit width10 mm

Leaf length62.5 mm

Leaf length max130 mm

Leaf length min50 mm

Leaf mass per area81.13 g/m2

Leaf size2 014 mm²

Leaf width25 mm

Leaf width max35 mm

Leaf width min15 mm

Petiole length0.75 cm

Plant height20 m

Plant height max20 m

Seed length9 mm

Seed width4.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timennnnnnnnyynn

Life formshrub or tree

Life spanperennial

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical narrowly_elliptical oblong obovate

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)11.88 mm²/mg

Wood density670 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arytera distylis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895521.1 ↗511 bpAustralia

ACGT

TTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGGGTTCCGCCCGAGGAAGC …

Arytera distylis voucher 129308728 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type699 records

Wild obs. + sensor426

Museum / vouchered194

Cultivated / captive2

Other77

Origin

Native42

Range

Area of Occupancy AOO1 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 337≤1 km 29≤10 km 9>10 km 5

380 georeferenced · 46 without coordinates

Open the mapobservation + sensor426

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 44≤1 km 15≤10 km 60>10 km 23

142 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence194

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	61
Mount Annan, AU	42
Museo Entomologico de Leonlocation not on record	30
Canberra, AU	14
Armidale, AU	13
Kew, GB	5
Saint Louis, US	4
Smithfield, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Claremont, US	1
Adelaide, AU	1
Glocation not on record	1

13 institutions · 179 of 194 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Arytera distylis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 19.7–19.7

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.4 °C

Min temp (night)15.6 °C

Precipitation89.6 mm/mo

Air humidity58.8 %

Moisture balance-29.8 mm/mo

Vapour deficit958 Pa

Wind speed2.60 m/s

Cloud cover24.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)