Arundo donax
speciesAt a glance
Occurrence records78 185
Data sources14
Biological traits128
DNA specimens40
eDNA detections33
Sources14 archives
Databases and archives Arundo donax's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility78 180 records↗
OBISOcean Biodiversity Information System5 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources128 traits
Chemical compositionLOTUS · NPASS78 compounds
Occurrence & distributionGBIF · OBIS78 185 records
Environmental DNA1 datasets · 8 countries33 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB2.7 Gbp
01Narrative
Arundo donax est une espèce de plantes herbacées de la famille des Poaceae, sous-famille des Arundinoideae, connue en France sous le nom de canne de Provence. Son cultivar panaché la rend plus attractive et on l'utilise beaucoup pour cette raison dans les parcs et jardins. Cette espèce figure dans la liste des cent espèces envahissantes parmi les plus nuisibles du monde de l'Union internationale pour la conservation de la nature (UICN).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology16
Fruit length2 mm
Inflorescence length max60 cm
Inflorescence length min30 cm
Leaf length550 mm
Leaf length max600 mm
Leaf length min500 mm
Leaf size12 000 mm²
Leaf width45 mm
⚠ sources differ — AusTraits: 45 mm · GIFT: 32 mm
Leaf width max70 mm
Leaf width min60 mm
Plant height4.35 m
⚠ sources differ — GIFT: 4.35 m · AusTraits: 6 m · USDA: 2.74 m · TRY: 3.08 m
Plant height max6 m
Plant height min2 m
Seed mass0.102 mg
Seed mass max0.1 mg
Seed mass min0.1 mg
Life cycle & reproduction34
After harvest regrowth rateRapid
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · GIFT: unspecialized
Flower conspicuousNo
Flower length max11 mm
Flower length min9 mm
Flowering endApr
Flowering startApr
Flowering timeyynnnnnnyyyy
Growth rate USDARapid
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualpresent
Resprout abilityNo
Resprouting capacityresprouts
Seed spread rateNone
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubtropical
Climberself-supporting
Elevation max3 000 m
Elevation mean875 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureCoarse
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: graminoid
Growth form USDARhizomatous
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassYes
Mycorrhiza type0.00000000787
Root depth min24 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min220 days
Leaf dry-matter content (LDMC)381 mg/g
Leaf n24.78 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min35 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceMedium
Soil pH max7 pH
Soil pH min4.8 pH
Specific leaf area (SLA)18.33 mm²/mg
Temperature min7 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousNo
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Planting density max7 200 per acre
Planting density min3 800 per acre
Seeds per fruit>1000
03Chemical composition78 compounds
Compounds documented for Arundo donax across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Simple indole alkaloids24
Oleanane triterpenoids5
Carboline alkaloids5
Simple oxindole alkaloids4
Ursane and Taraxastane triterpenoids3
Documented compounds78 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R)-1,2-dimethyl-1,3,4,9-tetrahydropyrido[3,4-b]indole | present | LOTUS | |
| (1R,3aR,4S,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-4,9-dihydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid | present | NPASS | |
| (1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-2-oxo-1-prop-1-en-2-yl-3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid | present | NPASS | |
| (1S,4aR,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bR)-1,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-4a-carboxylic acid | present | NPASS | |
| (2R,3R,4R,5R)-3,4-Dimethyl-2,5-bis(3,4,5-trimethoxyphenyl)tetrahydrofuran | present | NPASS | |
| (2S,4R)-1',2-dimethylspiro[1,2-dihydro-3,1-benzoxazine-4,3'-pyrrolidine]-2'-one | present | LOTUS | |
| (2S,6S)-2,3-dimethylspiro[1,3-oxazinane-6,3'-1H-indole]-2'-one | present | LOTUS | |
| (3aS,8bS)-4-[3-[2-(dimethylamino)ethyl]-5-hydroxy-1H-indol-4-yl]-3-methyl-2,3a-dihydro-1H-pyrrolo[2,3-b]indol-8b-ol | present | LOTUS | |
| (3R)-3-(2-aminophenyl)-3-hydroxy-1-methylpyrrolidin-2-one | present | LOTUS | |
| (3S)-3-hydroxy-3-[2-(methylamino)ethyl]-1H-indol-2-one | present | LOTUS |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arundo donax has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes5
GenBank sequences10
eDNA detections33
Countries8
The DNA barcodea real sequence read deposited for this species
GGGGCTTGCCCCGACACCCGGCTCAGGCCCCCGACCTCCGCGAGGAGGGGAGGGGCCGCAACAGAACCCACGGCGCCGAACGGCGTCAAG …
Arundo donax voucher PTMTMC 001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL9★rbcLa★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Arundo donax carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 738 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Arundo donax2.74 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 110 n = 55
Ploidypolyploid inferred
Chromosome records70–1122n range108median110mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 11015×CCDB · ita-fl · CCDB · iber-fl · CCDB · book-ipcn67-71 +3
CCDB · ita-fl — PIZZOLONGO P. - 1962. Osservazioni cariologiche su Arundo donax L. e Arundo plinii Turra.. Ann. Bot. (Rome) , 27(2): 173-187.
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-indian_vol2 — Hunter, A.W.S. 1934 ; Delay, C. 1947; Heiser, C.B. & Whitaker, T.W. 1948 ; Pizzolongo, P. 1962; Fernand- es, A. & Queiros, M. 1969
CCDB · book-fedorov — Hunter 1934
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-fedorov — Pizzolongo 1962
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Hunter, A. W. S. (1934). A karyosystematic investigation in the Gramineae Canad. J. Res. 11: 213-241.
2n 1089×CCDB · ita-fl · CCDB · iapt · CCDB · book-ipcn67-71 +2
CCDB · ita-fl — LOEVE A., LOEVE D. - 1973. IOPB chromosome number reports XL.. Taxon , 22(2-3): 285-291.
CCDB · iapt
CCDB · book-ipcn67-71 — CHRISTOPHER, J . & A. ABRAHAM. 1971. studies on the cytology and phylogeny of South Indian grasses I. Subfamilies Bambusoideae, Oryzoideae, Arundinoideae and Festucoideae. Cytologia 36: 579-594.
CCDB · book-indian_vol2 — Love, A. & Love, D. 1973
CCDB · book-indian_vol2 — Christopher, J. & Abraham, A. 1971
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1973b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 289.
2n 1004×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +1
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). III. Devesa, J. A. & al.Bol. Soc. Brot. ser. 264: 35-74(1991).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, M. C. Viera, R. Tormo, F. Vázquez, J. P. Carrasco, A. Ortega & J. Pastor. 1991. Contribución al conocimiento cariológico de las Poaceae en Extremadura (España)---III. Bol. Soc. Brot., sér. 2 64: 35–74.
CCDB · book-fedorov — ABAYJIOB 1931
CCDB · CromoCat 2015 — Devesa, J. A., Ruíz, T., Viera, M., Tormo, R., Vázquez, F., Carrasco, J., Ortega, A. & Pastor, J. (1991). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). III. Bol. Soc. Brot. 64: 35-74.
2n 723×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — CHRISTOPHER, J . & A. ABRAHAM. 1971. studies on the cytology and phylogeny of South Indian grasses I. Subfamilies Bambusoideae, Oryzoideae, Arundinoideae and Festucoideae. Cytologia 36: 579-594.
CCDB · book-indian_vol2 — Christopher, J. & Abraham, A. 1971
CCDB · CromoCat 2015 — Christopher, J. & Abrahan, A. (1971). Studies on the cytology and Phylogeny of South Indian grasses I. Subfamilies Bambusoideae, Oryzoideae, Arundinoideae and Festucoideae. Cytologia 36: 579-594.
2n 701×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mehra, P.N. & Kalia, V. 1975
2n 1121×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Gorenfiot, R. et al. 1972a
n 122×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Sahni, M. & S. S. Bir. 1985. SOCGI plant chromosome number reports -- III. J. Cytol. Genet. 20: 205–206.
CCDB · CromoCat 2015 — Sahni, M. & S.S. Bir. (1985). SOCGI plant chromosome number reports -- III. Journal of Cytology and Genetics 20: 205-206
n 352×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Mehra & Kalia 1975
CCDB · CromoCat 2015 — Mehra, P. N. & V. Kalia. (1975). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 511.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type78 185 records
Wild obs. + sensor72 443
Museum / vouchered3 551
Cultivated / captive25
Other2 166
Origin
Native27
Introduced14 946
Range
Area of Occupancy AOO103 396 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 26 453≤1 km 16 633≤10 km 10 838>10 km 818
54 742 georeferenced · 17 701 without coordinates
Open the mapobservation + sensor72 443
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy69% within 1 km
≤100 m 439≤1 km 298≤10 km 288>10 km 38
1 063 georeferenced · 2 488 without coordinates
Open the institutions mapphysical evidence3 551
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4
4 georeferenced · 21 without coordinates
Open the mapnot free-living25
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions182 of 317 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 758 |
| San Diego, US | 87 |
| Durango, MX | 81 |
| Beijing, CN | 61 |
| Austin, US | 57 |
| Sanda, JP | 57 |
| Saint Louis, US | 57 |
| Brisbane, AU | 54 |
| Chengdu, CN | 53 |
| Claremont, US | 52 |
| Christchurch, NZ | 47 |
| Adelaide, AU | 45 |
| Fort Worth, US | 39 |
| ASUlocation not on record | 38 |
| Bronx, US | 37 |
| Santa Barbara, US | 36 |
| Riverside, US | 33 |
| Tampa, US | 33 |
| Kunming, CN | 32 |
| Mount Annan, AU | 29 |
| Paris, FR | 29 |
| Kensington, AU | 29 |
| Canberra, AU | 29 |
| BDBClocation not on record | 28 |
| Auckland, NZ | 27 |
| Jena Microbial Resource Collectionlocation not on record | 27 |
| University of Stellenboschlocation not on record | 27 |
| Guilin, CN | 27 |
| CASlocation not on record | 26 |
| Odawara, JP | 26 |
| Mexico City, MX | 26 |
| Museo Entomologico de Leonlocation not on record | 25 |
| Texas Lutheran Universitylocation not on record | 23 |
| Canadian Department of Agriculturelocation not on record | 23 |
| Kochi, JP | 22 |
| Ann Arbor, US | 21 |
| València, ES | 21 |
| Chengdu, CN | 21 |
| Edinburgh, GB | 21 |
| Tokushima, JP | 21 |
| TAIElocation not on record | 20 |
| Flagstaff, US | 20 |
| Taipei, TW | 19 |
| Barcelona, ES | 18 |
| Davis, US | 18 |
| Palmerston, AU | 18 |
| Knoxville, US | 17 |
| Pretoria, ZA | 17 |
| Logan, US | 16 |
| MAlocation not on record | 16 |
| Mexico City, MX | 16 |
| Phoenix, US | 15 |
| Guangzhou, CN | 15 |
| Badajoz, ES | 14 |
| Chapingo, MX | 14 |
| Durban, ZA | 14 |
| QAUlocation not on record | 14 |
| South Kensington, GB | 14 |
| BClocation not on record | 14 |
| San Isidro, AR | 13 |
| BAYLUlocation not on record | 13 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 13 |
| Nishihara, JP | 13 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 13 |
| Chiba, JP | 12 |
| Kew, GB | 12 |
| Berlin, DE | 12 |
| Granada, ES | 11 |
| Jaén, ES | 11 |
| Torreón, MX | 11 |
| Moscow State Universitylocation not on record | 11 |
| Université de Bordeauxlocation not on record | 11 |
| Hazara Universitylocation not on record | 11 |
| Cape Town, ZA | 11 |
| Chapel Hill, US | 10 |
| EL PASO, US | 10 |
| Muzaffarabad, PK | 10 |
| Arcata, US | 10 |
| Zapopan, MX | 10 |
| Mérida, MX | 10 |
| Guangzhou, CN | 9 |
| Wlocation not on record | 9 |
| FJIDClocation not on record | 9 |
| Irvine, US | 9 |
| Columbia, US | 9 |
| Montecillo, Texcoco, MX | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| Severin-McDaniel Insect Collectionlocation not on record | 9 |
| La Paz, MX | 8 |
| Ciudad Juárez, MX | 8 |
| Olocation not on record | 8 |
| Guasave, MX | 8 |
| LDlocation not on record | 8 |
| San Luis Obispo, US | 8 |
| Taipei, TW | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| Xining, CN | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Córdoba, ES | 7 |
| Valdosta State Universitylocation not on record | 7 |
| Hermosillo, MX | 7 |
| Portland, US | 7 |
| Córdoba, AR | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Rotorua, NZ | 7 |
| Tsukuba, JP | 7 |
| GAlocation not on record | 6 |
| Albuquerque, US | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| US | 6 |
| Miami, US | 6 |
| Corvallis, US | 6 |
| Denton, US | 6 |
| Yunnan Universitylocation not on record | 6 |
| Wellington, NZ | 6 |
| Blumenau, BR | 6 |
| Taipei, TW | 6 |
| Wuzhou, CN | 6 |
| UnBlocation not on record | 5 |
| Vitoria, ES | 5 |
| Puerto Ayora, EC | 5 |
| Little Rock, US | 5 |
| Armidale, AU | 5 |
| Castelar, AR | 5 |
| CJBGlocation not on record | 5 |
| San Angelo, US | 5 |
| Wuhan, CN | 5 |
| Juriquilla, MX | 5 |
| Bangkok, TH | 5 |
| Lubbock, US | 4 |
| Salamanca, ES | 4 |
| Université de Strasbourglocation not on record | 4 |
| MeiseBGlocation not on record | 4 |
| Ciudad de México, MX | 4 |
| Williamsburg, US | 4 |
| University of Johannesburglocation not on record | 4 |
| BISHlocation not on record | 4 |
| James Cook Townsvillelocation not on record | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 4 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 4 |
| Smithfield, AU | 4 |
| Mississippi State, US | 4 |
| GMBAlocation not on record | 4 |
| GJOlocation not on record | 4 |
| Brasília, BR | 4 |
| Baroda, IN | 4 |
| Nishihara, JP | 4 |
| Texas A&M Universitylocation not on record | 4 |
| Catalina Island Conservancylocation not on record | 4 |
| Xiamen, CN | 4 |
| Bureau of Land Management, Medford District Officelocation not on record | 3 |
| Nanjing, CN | 3 |
| XALlocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Mexico City, MX | 3 |
| Nagano City, JP | 3 |
| Austin, US | 3 |
| Aarhus, DK | 3 |
| Dekalb, US | 3 |
| Fayetteville, US | 3 |
| Norfolk, US | 3 |
| Toluca, MX | 3 |
| College Park, US | 3 |
| Oskarshamn, SE | 3 |
| Tapachula, MX | 3 |
| Mazatlán, MX | 3 |
| Tuscaloosa, US | 3 |
| Ensenada, MX | 3 |
| La Trobe Universitylocation not on record | 3 |
| Stockholm, SE | 3 |
| Dehra Dun, IN | 3 |
| Tlalnepantla, MX | 3 |
| nlocation not on record | 3 |
| UIBlocation not on record | 3 |
| Sendai, JP | 3 |
| AUAlocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| The University of Arizonalocation not on record | 3 |
| California Academy of Scienceslocation not on record | 3 |
| Bloomington, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Chicago, US | 3 |
| US | 3 |
| Long Beach, US | 3 |
| Los Angeles, US | 3 |
| Culiacán, MX | 3 |
| Honolulu, US | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Sevilla, ES | 2 |
| Northridge, US | 2 |
| Zürich, CH | 2 |
| Pondicherry, IN | 2 |
| Corrientes, AR | 2 |
| Alicante, ES | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Henderson State Universitylocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| UFSClocation not on record | 2 |
| Jackson, US | 2 |
| Fundación Miguel Lillolocation not on record | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| Hobart, AU | 2 |
| St. Augustine, TT | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| KURAlocation not on record | 2 |
| USFSlocation not on record | 2 |
| Kagoshima, JP | 2 |
| UFBAlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Madrid, ES | 2 |
| Altos de Pipe, VE | 2 |
| Burlington, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 2 |
| Loja, EC | 2 |
| Vancouver, CA | 2 |
| Stephenville, US | 2 |
| Porrentruy, CH | 2 |
| ISAlocation not on record | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Jinghong, CN | 2 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 2 |
| Toyama, JP | 2 |
| Portland, US | 2 |
| Morelia, MX | 1 |
| MCNAMlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| La Paz, BO | 1 |
| MEXUlocation not on record | 1 |
| JBSlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Zhejiang Universitylocation not on record | 1 |
| León, NI | 1 |
| Hangzhou, CN | 1 |
| Bourges, FR | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Quito, EC | 1 |
| San Jose, US | 1 |
| TLAXlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| GB | 1 |
| Bando, JP | 1 |
| Henderson, US | 1 |
| QCNElocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Criciúma, BR | 1 |
| Musée des Confluenceslocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Ashland, US | 1 |
| Universidade Federal de Pelotaslocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Dresden, DE | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| BRNUlocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Zacatecas, MX | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Changsha, CN | 1 |
| Salvador, BR | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 1 |
| WTUlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Cape Town, ZA | 1 |
| Montréal, CA | 1 |
| Santa Cruz, US | 1 |
| KR | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Philadelphia, US | 1 |
| Tomioka, JP | 1 |
| IPA/SPlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Fullerton, US | 1 |
| San Bernardino, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| UDESC-CAVlocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Coimbra, PT | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Pullman, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| EMTCMlocation not on record | 1 |
317 institutions · 3 437 of 3 551 vouchered records shown · 90 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Arundo donax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map8 countries0
Riparian with Quercus agrifolia var. agrifol…Grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.2 °C 10.1–22.2
Seasonal swing summer↔winter19.0 °C
Max temp (day)24.8 °C 15.7–25.5
Min temp (night)16.5 °C 6.40–18.2
Precipitation47.4 mm/mo 12.0–70.9
Air humidity60.9 % 45.7–61.2
Moisture balance-45.6 mm/mo -108–-7.70
Vapour deficit1,043 Pa 764–1,082
Wind speed2.30 m/s 1.90–4.60
Cloud cover36.8 % 15.4–40.9
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.