Arum pictum

L.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Arum

At a glance

Occurrence records1 212

Data sources10

Biological traits10

DNA specimens31

eDNA detections30

Sources10 archives

Databases and archives Arum pictum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF1 212 records

Environmental DNA1 datasets · 4 countries30 detections

DNA & barcodingBOLD · NCBI31 specimens

Genome at a glanceCCDB2n = 28

01Narrative

لوف صبغي هو نوع من النباتات يتبع جنس اللوف من الفصيلة اللوفية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass32.93 mg

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Geophyte

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)31.23 mm²/mg

03Chemical composition2 compounds

Compounds documented for Arum pictum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carbocyclic fatty acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
13-Phenyltridecanoic acid		present	LOTUS
15-Phenylpentadecanoic acid		present	LOTUS

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arum pictum has left across the world's sequence archives.

At a glance

DNA specimens31

Marker genes3

GenBank sequences10

eDNA detections30

Countries4

The DNA barcodea real sequence read deposited for this species

rbcLEU193258.1 ↗1 242 bpFrance

ACGT

CCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCA …

Arum pictum isolate A81 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arum pictum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2817×CCDB · ita-fl · CCDB · fl-europaea · CCDB · book-ipcn65 +4

CCDB · ita-fl — MONTI G., PAGNI A.M., VIEGI L. - 1978. Numeri cromosomici per la flora italiana:416-422.. Inform. Bot. Ital. , 10(1): 101-110.

CCDB · ita-fl — BACCHETTA G., BOSCAIU M. & GUEMES J. - 2001 (2001). Numeros cromosomaticos de plantas occidentales, 863-879.. Anales Jardin Botanico de Madrid , 58(2): 341-342.

CCDB · ita-fl — BEDALOV M., MATTER B., KUPFER P. - 2002. IOPB Chomosome Data 18. IN: Kirschner J., Drabkova L., Stace A. C., - IOPB Newsletter , 34: 20.

CCDB · fl-europaea — Contandriopoulos

CCDB · book-ipcn65 — Erbrich 1965

CCDB · ipcn-api-dl — Bedalov, M. 1978. 2317. Bull. Soc. Neuchateloise Sci. Nat. 101: 85–93.

CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco & P. Medagli. 1993. Chromosome numbers and karyotypes in Arum (Araceae). Caryologia 46: 161–170.

CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco, P. Medagli, M. Bedalov & F. Piccarreta. 1993. Indagini cariologiche su alcune specie di Arum L. (Araceae). Giorn. Bot. Ital. 127(3): 514.

CCDB · ipcn-api-dl — Bedalov, M., B. Matter & P. Küpfer. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 20.

CCDB · ipcn-api-dl — Bedalov, M., D. D. Munt, A. R. Graell & P. Küpfer. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 21–22.

CCDB · ipcn-api-dl — Bacchetta, G. 2001. Números cromosomáticos de plantas occidentales, 863--879. Anales Jard. Bot. Madrid 58(2): 341–342.

CCDB · ipcn-api-dl — MONTI, G., A. M. PAGNI & L. VIEGI. 1978. Numeri cromosomici per la flora Italiana: 416-422. Inform. Bot. Ital. 10: 101–110.

CCDB · book-ipcn67-71 — CONTANDRIOPOULOS, J. 1962. Recherches sur la flore endemique de la Corse et sur ses origines. Ann. Faculte Sci. Marseille 32: 1-354.

CCDB · araceae — D'Emerico et al., 1993

CCDB · CromoCat 2015 — Bachetta, G. (2000). Números cromosomáticos de plantas occidentales, 863-879. Anales Jard. Bot. Madrid 58(2): 341-342.

CCDB · CromoCat 2015 — Bedalov, M., Draper Munt, D., Rossello Graell, A. & Küpfer, P. (2002d). Reports (IOPB Chromosome Data 18) Int. Organ. Pl. Biosyst. Newslett. 34: 21-22.

CCDB · CromoCat 2015 — Bedalov, M., Matter, B. & Küpfer, P. (2002b). Reports (IOPB Chromosome Data 18) Int. Organ. Pl. Biosyst. Newslett. 34: 20.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 212 records

Wild obs. + sensor1 163

Museum / vouchered47

Cultivated / captive2

Range

Area of Occupancy AOO2 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 602≤1 km 120≤10 km 200>10 km 25

947 georeferenced · 216 without coordinates

Open the mapobservation + sensor1 163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 4≤10 km 10

15 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence47

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CJBGlocation not on record	5
MAlocation not on record	4
Zürich, CH	2
Chicago, US	2
Barcelona, ES	1
Wlocation not on record	1
BClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Bloomington, US	1

9 institutions · 18 of 47 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA30 detections

Where the DNA of Arum pictum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 11.3–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 15.1–18.9

Min temp (night)9.30 °C 7.30–9.30

Precipitation72.2 mm/mo 72.2–76.5

Air humidity58.3 % 58.3–62.5

Moisture balance-20.6 mm/mo -20.6–-8.00

Vapour deficit782 Pa 552–782

Wind speed2.60 m/s 2.60–4.60

Cloud cover40.9 % 40.9–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arum pictum

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 212 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 212 records